ID: 978650504

View in Genome Browser
Species Human (GRCh38)
Location 4:110998310-110998332
Sequence TCTTGGGTCCAGAAGCATCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978650500_978650504 -2 Left 978650500 4:110998289-110998311 CCAGTCTTGCATTTACCAACGTC No data
Right 978650504 4:110998310-110998332 TCTTGGGTCCAGAAGCATCCCGG No data
978650499_978650504 18 Left 978650499 4:110998269-110998291 CCTTGCACAATTCTCAGTAACCA No data
Right 978650504 4:110998310-110998332 TCTTGGGTCCAGAAGCATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978650504 Original CRISPR TCTTGGGTCCAGAAGCATCC CGG Intergenic
No off target data available for this crispr