ID: 978653117

View in Genome Browser
Species Human (GRCh38)
Location 4:111031999-111032021
Sequence CAAAGCACGGAGAAGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978653112_978653117 1 Left 978653112 4:111031975-111031997 CCATTGAGATCTATAGAGCAGCA No data
Right 978653117 4:111031999-111032021 CAAAGCACGGAGAAGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978653117 Original CRISPR CAAAGCACGGAGAAGAAGGA GGG Intergenic
No off target data available for this crispr