ID: 978654252

View in Genome Browser
Species Human (GRCh38)
Location 4:111048211-111048233
Sequence AGGGAGAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978654243_978654252 23 Left 978654243 4:111048165-111048187 CCCCAACCTCCAAGTGACATGAA No data
Right 978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG No data
978654238_978654252 30 Left 978654238 4:111048158-111048180 CCCTCCCCCCCAACCTCCAAGTG No data
Right 978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG No data
978654247_978654252 14 Left 978654247 4:111048174-111048196 CCAAGTGACATGAAGAAAGAGTC No data
Right 978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG No data
978654242_978654252 24 Left 978654242 4:111048164-111048186 CCCCCAACCTCCAAGTGACATGA No data
Right 978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG No data
978654239_978654252 29 Left 978654239 4:111048159-111048181 CCTCCCCCCCAACCTCCAAGTGA No data
Right 978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG No data
978654245_978654252 21 Left 978654245 4:111048167-111048189 CCAACCTCCAAGTGACATGAAGA No data
Right 978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG No data
978654241_978654252 25 Left 978654241 4:111048163-111048185 CCCCCCAACCTCCAAGTGACATG No data
Right 978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG No data
978654244_978654252 22 Left 978654244 4:111048166-111048188 CCCAACCTCCAAGTGACATGAAG No data
Right 978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG No data
978654240_978654252 26 Left 978654240 4:111048162-111048184 CCCCCCCAACCTCCAAGTGACAT No data
Right 978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG No data
978654246_978654252 17 Left 978654246 4:111048171-111048193 CCTCCAAGTGACATGAAGAAAGA No data
Right 978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978654252 Original CRISPR AGGGAGAGCACAGTGATTGT GGG Intergenic