ID: 978655904

View in Genome Browser
Species Human (GRCh38)
Location 4:111065038-111065060
Sequence AGGGGAAAACAGGACATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978655901_978655904 -7 Left 978655901 4:111065022-111065044 CCTTCAGAGCATTTTCAGGGGAA No data
Right 978655904 4:111065038-111065060 AGGGGAAAACAGGACATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978655904 Original CRISPR AGGGGAAAACAGGACATTGG TGG Intergenic
No off target data available for this crispr