ID: 978657100

View in Genome Browser
Species Human (GRCh38)
Location 4:111077138-111077160
Sequence CAGTGTTAGATCAATGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978657096_978657100 16 Left 978657096 4:111077099-111077121 CCTACACAATGATAGTGGGAGAC 0: 21
1: 1241
2: 5057
3: 5057
4: 1940
Right 978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978657100 Original CRISPR CAGTGTTAGATCAATGAGAC AGG Intergenic
No off target data available for this crispr