ID: 978659548

View in Genome Browser
Species Human (GRCh38)
Location 4:111108313-111108335
Sequence TCTGGTTTTCTAAAAGTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978659548_978659555 13 Left 978659548 4:111108313-111108335 CCACATACTTTTAGAAAACCAGA No data
Right 978659555 4:111108349-111108371 CAATCACAAGAACAGCAAGGGGG 0: 7
1: 260
2: 1116
3: 2587
4: 4946
978659548_978659552 10 Left 978659548 4:111108313-111108335 CCACATACTTTTAGAAAACCAGA No data
Right 978659552 4:111108346-111108368 ACTCAATCACAAGAACAGCAAGG No data
978659548_978659554 12 Left 978659548 4:111108313-111108335 CCACATACTTTTAGAAAACCAGA No data
Right 978659554 4:111108348-111108370 TCAATCACAAGAACAGCAAGGGG No data
978659548_978659553 11 Left 978659548 4:111108313-111108335 CCACATACTTTTAGAAAACCAGA No data
Right 978659553 4:111108347-111108369 CTCAATCACAAGAACAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978659548 Original CRISPR TCTGGTTTTCTAAAAGTATG TGG (reversed) Intergenic
No off target data available for this crispr