ID: 978659550

View in Genome Browser
Species Human (GRCh38)
Location 4:111108331-111108353
Sequence GATTGAGTTCTCCTGAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978659550_978659555 -5 Left 978659550 4:111108331-111108353 CCAGACCTCAGGAGAACTCAATC No data
Right 978659555 4:111108349-111108371 CAATCACAAGAACAGCAAGGGGG 0: 7
1: 260
2: 1116
3: 2587
4: 4946
978659550_978659553 -7 Left 978659550 4:111108331-111108353 CCAGACCTCAGGAGAACTCAATC No data
Right 978659553 4:111108347-111108369 CTCAATCACAAGAACAGCAAGGG No data
978659550_978659554 -6 Left 978659550 4:111108331-111108353 CCAGACCTCAGGAGAACTCAATC No data
Right 978659554 4:111108348-111108370 TCAATCACAAGAACAGCAAGGGG No data
978659550_978659552 -8 Left 978659550 4:111108331-111108353 CCAGACCTCAGGAGAACTCAATC No data
Right 978659552 4:111108346-111108368 ACTCAATCACAAGAACAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978659550 Original CRISPR GATTGAGTTCTCCTGAGGTC TGG (reversed) Intergenic
No off target data available for this crispr