ID: 978659552

View in Genome Browser
Species Human (GRCh38)
Location 4:111108346-111108368
Sequence ACTCAATCACAAGAACAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978659550_978659552 -8 Left 978659550 4:111108331-111108353 CCAGACCTCAGGAGAACTCAATC No data
Right 978659552 4:111108346-111108368 ACTCAATCACAAGAACAGCAAGG No data
978659548_978659552 10 Left 978659548 4:111108313-111108335 CCACATACTTTTAGAAAACCAGA No data
Right 978659552 4:111108346-111108368 ACTCAATCACAAGAACAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978659552 Original CRISPR ACTCAATCACAAGAACAGCA AGG Intergenic
No off target data available for this crispr