ID: 978659554

View in Genome Browser
Species Human (GRCh38)
Location 4:111108348-111108370
Sequence TCAATCACAAGAACAGCAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978659548_978659554 12 Left 978659548 4:111108313-111108335 CCACATACTTTTAGAAAACCAGA No data
Right 978659554 4:111108348-111108370 TCAATCACAAGAACAGCAAGGGG No data
978659550_978659554 -6 Left 978659550 4:111108331-111108353 CCAGACCTCAGGAGAACTCAATC No data
Right 978659554 4:111108348-111108370 TCAATCACAAGAACAGCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978659554 Original CRISPR TCAATCACAAGAACAGCAAG GGG Intergenic
No off target data available for this crispr