ID: 978659555

View in Genome Browser
Species Human (GRCh38)
Location 4:111108349-111108371
Sequence CAATCACAAGAACAGCAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8916
Summary {0: 7, 1: 260, 2: 1116, 3: 2587, 4: 4946}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978659550_978659555 -5 Left 978659550 4:111108331-111108353 CCAGACCTCAGGAGAACTCAATC No data
Right 978659555 4:111108349-111108371 CAATCACAAGAACAGCAAGGGGG 0: 7
1: 260
2: 1116
3: 2587
4: 4946
978659551_978659555 -10 Left 978659551 4:111108336-111108358 CCTCAGGAGAACTCAATCACAAG No data
Right 978659555 4:111108349-111108371 CAATCACAAGAACAGCAAGGGGG 0: 7
1: 260
2: 1116
3: 2587
4: 4946
978659548_978659555 13 Left 978659548 4:111108313-111108335 CCACATACTTTTAGAAAACCAGA No data
Right 978659555 4:111108349-111108371 CAATCACAAGAACAGCAAGGGGG 0: 7
1: 260
2: 1116
3: 2587
4: 4946

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978659555 Original CRISPR CAATCACAAGAACAGCAAGG GGG Intergenic
Too many off-targets to display for this crispr