ID: 978661174

View in Genome Browser
Species Human (GRCh38)
Location 4:111128367-111128389
Sequence CAAGTTTGATAGGTGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978661174_978661184 24 Left 978661174 4:111128367-111128389 CCCAGGTCCACCTATCAAACTTG No data
Right 978661184 4:111128414-111128436 TACAAAGGGAAACAAGACAATGG No data
978661174_978661181 9 Left 978661174 4:111128367-111128389 CCCAGGTCCACCTATCAAACTTG No data
Right 978661181 4:111128399-111128421 CAAGGGCCAAAAAAGTACAAAGG No data
978661174_978661182 10 Left 978661174 4:111128367-111128389 CCCAGGTCCACCTATCAAACTTG No data
Right 978661182 4:111128400-111128422 AAGGGCCAAAAAAGTACAAAGGG No data
978661174_978661179 -9 Left 978661174 4:111128367-111128389 CCCAGGTCCACCTATCAAACTTG No data
Right 978661179 4:111128381-111128403 TCAAACTTGGAAGTAAAGCAAGG No data
978661174_978661180 -8 Left 978661174 4:111128367-111128389 CCCAGGTCCACCTATCAAACTTG No data
Right 978661180 4:111128382-111128404 CAAACTTGGAAGTAAAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978661174 Original CRISPR CAAGTTTGATAGGTGGACCT GGG (reversed) Intergenic
No off target data available for this crispr