ID: 978661865

View in Genome Browser
Species Human (GRCh38)
Location 4:111137011-111137033
Sequence TTCTGGACACAGCTGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978661865_978661872 -4 Left 978661865 4:111137011-111137033 CCAAGCCCCAGCTGTGTCCAGAA No data
Right 978661872 4:111137030-111137052 AGAAGTGCTGTCCAGGATCAGGG No data
978661865_978661874 28 Left 978661865 4:111137011-111137033 CCAAGCCCCAGCTGTGTCCAGAA No data
Right 978661874 4:111137062-111137084 AGAAACCTTAGAAATCTGCCTGG No data
978661865_978661871 -5 Left 978661865 4:111137011-111137033 CCAAGCCCCAGCTGTGTCCAGAA No data
Right 978661871 4:111137029-111137051 CAGAAGTGCTGTCCAGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978661865 Original CRISPR TTCTGGACACAGCTGGGGCT TGG (reversed) Intergenic
No off target data available for this crispr