ID: 978662826

View in Genome Browser
Species Human (GRCh38)
Location 4:111149142-111149164
Sequence TCATACTGAATGGGTAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978662826_978662831 -10 Left 978662826 4:111149142-111149164 CCAGTTTTACCCATTCAGTATGA No data
Right 978662831 4:111149155-111149177 TTCAGTATGATATTGGCTGTGGG 0: 9694
1: 5341
2: 4248
3: 3740
4: 3283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978662826 Original CRISPR TCATACTGAATGGGTAAAAC TGG (reversed) Intergenic
No off target data available for this crispr