ID: 978663363

View in Genome Browser
Species Human (GRCh38)
Location 4:111154191-111154213
Sequence CTCAGGACCTGCTGAATGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978663363_978663371 21 Left 978663363 4:111154191-111154213 CCCAACATTCAGCAGGTCCTGAG No data
Right 978663371 4:111154235-111154257 GAATGAGGTACGTGAACAAGTGG No data
978663363_978663367 -4 Left 978663363 4:111154191-111154213 CCCAACATTCAGCAGGTCCTGAG No data
Right 978663367 4:111154210-111154232 TGAGGTCTTGTCCTGTGTCCTGG No data
978663363_978663368 6 Left 978663363 4:111154191-111154213 CCCAACATTCAGCAGGTCCTGAG No data
Right 978663368 4:111154220-111154242 TCCTGTGTCCTGGAAGAATGAGG 0: 3
1: 72
2: 176
3: 457
4: 861
978663363_978663372 24 Left 978663363 4:111154191-111154213 CCCAACATTCAGCAGGTCCTGAG No data
Right 978663372 4:111154238-111154260 TGAGGTACGTGAACAAGTGGAGG No data
978663363_978663373 25 Left 978663363 4:111154191-111154213 CCCAACATTCAGCAGGTCCTGAG No data
Right 978663373 4:111154239-111154261 GAGGTACGTGAACAAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978663363 Original CRISPR CTCAGGACCTGCTGAATGTT GGG (reversed) Intergenic
No off target data available for this crispr