ID: 978663366

View in Genome Browser
Species Human (GRCh38)
Location 4:111154208-111154230
Sequence AGGACACAGGACAAGACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978663366_978663374 25 Left 978663366 4:111154208-111154230 CCTGAGGTCTTGTCCTGTGTCCT No data
Right 978663374 4:111154256-111154278 GGAGGGTGAGCAAAGTGAAGAGG No data
978663366_978663373 8 Left 978663366 4:111154208-111154230 CCTGAGGTCTTGTCCTGTGTCCT No data
Right 978663373 4:111154239-111154261 GAGGTACGTGAACAAGTGGAGGG No data
978663366_978663372 7 Left 978663366 4:111154208-111154230 CCTGAGGTCTTGTCCTGTGTCCT No data
Right 978663372 4:111154238-111154260 TGAGGTACGTGAACAAGTGGAGG No data
978663366_978663371 4 Left 978663366 4:111154208-111154230 CCTGAGGTCTTGTCCTGTGTCCT No data
Right 978663371 4:111154235-111154257 GAATGAGGTACGTGAACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978663366 Original CRISPR AGGACACAGGACAAGACCTC AGG (reversed) Intergenic
No off target data available for this crispr