ID: 978663367

View in Genome Browser
Species Human (GRCh38)
Location 4:111154210-111154232
Sequence TGAGGTCTTGTCCTGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978663361_978663367 22 Left 978663361 4:111154165-111154187 CCTGTTTGTGTTACAGCTCTTTC 0: 146
1: 265
2: 265
3: 197
4: 317
Right 978663367 4:111154210-111154232 TGAGGTCTTGTCCTGTGTCCTGG No data
978663363_978663367 -4 Left 978663363 4:111154191-111154213 CCCAACATTCAGCAGGTCCTGAG No data
Right 978663367 4:111154210-111154232 TGAGGTCTTGTCCTGTGTCCTGG No data
978663364_978663367 -5 Left 978663364 4:111154192-111154214 CCAACATTCAGCAGGTCCTGAGG No data
Right 978663367 4:111154210-111154232 TGAGGTCTTGTCCTGTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978663367 Original CRISPR TGAGGTCTTGTCCTGTGTCC TGG Intergenic
No off target data available for this crispr