ID: 978663368

View in Genome Browser
Species Human (GRCh38)
Location 4:111154220-111154242
Sequence TCCTGTGTCCTGGAAGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1569
Summary {0: 3, 1: 72, 2: 176, 3: 457, 4: 861}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978663363_978663368 6 Left 978663363 4:111154191-111154213 CCCAACATTCAGCAGGTCCTGAG No data
Right 978663368 4:111154220-111154242 TCCTGTGTCCTGGAAGAATGAGG 0: 3
1: 72
2: 176
3: 457
4: 861
978663364_978663368 5 Left 978663364 4:111154192-111154214 CCAACATTCAGCAGGTCCTGAGG No data
Right 978663368 4:111154220-111154242 TCCTGTGTCCTGGAAGAATGAGG 0: 3
1: 72
2: 176
3: 457
4: 861

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978663368 Original CRISPR TCCTGTGTCCTGGAAGAATG AGG Intergenic
900234058 1:1578252-1578274 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
900437254 1:2636945-2636967 TCCCGTGTCCAAGAAGAATGAGG + Intronic
901041650 1:6367852-6367874 CCCTGTGACCAGGAAGAATGAGG + Intronic
901403503 1:9031134-9031156 TCCCGCATCCAGGAAGAATGAGG + Intergenic
901550104 1:9989723-9989745 TCCAGTGTCCAGGAGGAATGAGG - Intergenic
901691252 1:10974621-10974643 TCCTGTGTCCAGGAAGAATGAGG - Intronic
901936658 1:12631416-12631438 TCCTGCAACCAGGAAGAATGAGG - Intergenic
903008231 1:20312469-20312491 ACCTGTGGCATGGAAGATTGGGG - Intronic
903082424 1:20821029-20821051 TCCTGTGTCCAGGAAGAATGAGG - Intronic
903101826 1:21036358-21036380 TCCTGCGTCCAGGAAGATTGAGG - Intronic
903337440 1:22634574-22634596 TCCTGCAACCAGGAAGAATGAGG + Intergenic
903805084 1:25999480-25999502 TCTTGGCTCCTGGAAGGATGGGG - Intergenic
904045780 1:27607409-27607431 TCCTGTGGCCTAGAGGAATGTGG - Intergenic
904222487 1:28983918-28983940 TCCGGTGTCCAGGAAAAATGAGG + Intronic
904355334 1:29935011-29935033 TCCTGGGGCCTGGAACACTGTGG - Intergenic
904370144 1:30043079-30043101 TCCTGTGTCTAGGAAGAATGAGG - Intergenic
904443842 1:30551556-30551578 TCCTGCATCCAGGAAGAATGAGG - Intergenic
904551835 1:31325296-31325318 TCTTGCATCCAGGAAGAATGAGG - Intronic
904577369 1:31513675-31513697 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
904732649 1:32606547-32606569 TCCTGCATCCGAGAAGAATGAGG + Intronic
905001383 1:34672401-34672423 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
905256789 1:36689831-36689853 TCCTGTGTGCAGGGGGAATGGGG + Intergenic
905546157 1:38801982-38802004 TCCTGTGACCAGGAAGAATGAGG - Intergenic
905746679 1:40424095-40424117 TCCTGTGTCCAGGTAAAATGGGG + Intergenic
905767058 1:40610089-40610111 TCCAGTATCCAGGAAAAATGAGG - Intergenic
905839535 1:41162915-41162937 TCCTGCAACCAGGAAGAATGAGG - Intronic
906051766 1:42880393-42880415 TCCTGCATCCAGGAAGAATGAGG + Intergenic
906082344 1:43101625-43101647 TCCTGCAACCAGGAAGAATGAGG + Intergenic
906122276 1:43402176-43402198 TCCTGTGTCCCTGATTAATGAGG - Intronic
906132390 1:43468469-43468491 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
906516279 1:46440652-46440674 TTGGGTGTCCTGAAAGAATGAGG - Intergenic
906854835 1:49292871-49292893 TCTTGTGTCCAGGAAAAATGAGG - Intronic
906913591 1:49983069-49983091 TCCCATGTCCAGGAAGAATGAGG - Intronic
907020319 1:51060403-51060425 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
907153019 1:52306499-52306521 TCCTGCATCCAGGAAGAATGAGG - Intronic
907252979 1:53155399-53155421 TCCTGCATCCAGGAAGAATAAGG - Intergenic
907353991 1:53857110-53857132 TCCTGTGGCTTCGTAGAATGAGG - Intronic
907603746 1:55794896-55794918 TCCTGCATCCAGAAAGAATGAGG - Intergenic
907614855 1:55913302-55913324 TCCTGCACCCAGGAAGAATGAGG - Intergenic
907761880 1:57368743-57368765 TCCTGTGTCTAGGAAGAATGAGG - Intronic
908702797 1:66920363-66920385 TCCAGTGTCCAGGAGGAATGAGG - Intronic
908730985 1:67226295-67226317 TCCAGTGTCCAGGAAGAATCAGG + Intronic
908896798 1:68910056-68910078 TCCAGTGTCCAAGAAGAATCAGG - Intergenic
909185606 1:72481822-72481844 TCTGGTGTCTAGGAAGAATGAGG + Intergenic
909199361 1:72669975-72669997 GCCTGTGTACTTGGAGAATGGGG - Intergenic
909238226 1:73180274-73180296 TCCTGCATCCAGGAAGAATGAGG + Intergenic
909282368 1:73771258-73771280 TCCTGCGACCAGGAAGAATGAGG - Intergenic
909599701 1:77448608-77448630 TCCTGCAACCAGGAAGAATGAGG - Intronic
909926132 1:81439857-81439879 TCCAGTGTCCAAGAAGAATGAGG + Intronic
910000068 1:82330947-82330969 TCCTGCATCCAAGAAGAATGAGG + Intergenic
910105642 1:83628619-83628641 CCCTGTGTTCTGGAATAAAGAGG - Intergenic
910190061 1:84585931-84585953 ACCTGTGCACTGGAAGAGTGGGG - Intergenic
910259933 1:85284749-85284771 TCCTGTGTCTAGGAAGAATGAGG - Intergenic
910602081 1:89043124-89043146 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
910654894 1:89609574-89609596 ACCTGCGACCAGGAAGAATGAGG + Intergenic
911004092 1:93199657-93199679 TCCTGCATCCAGGAAGAATGAGG + Intronic
911267001 1:95754213-95754235 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
911275624 1:95854256-95854278 TCCTGAGACCAGGAAGAATGAGG - Intergenic
911435035 1:97845589-97845611 TCCCATGTCCAGGAAGAATGAGG - Intronic
911486938 1:98514386-98514408 TCATGTGTCCATGGAGAATGGGG + Intergenic
911546609 1:99224978-99225000 TCCAGCGTCCAGGAAGAATTAGG + Intergenic
911608605 1:99936200-99936222 TCCTGCATCCAAGAAGAATGAGG - Intergenic
911643648 1:100315898-100315920 TCCTGCGTCCAAGAAGAATGAGG + Intergenic
912008653 1:104933316-104933338 TCCGGAGTCCAGGAAAAATGAGG - Intergenic
912062103 1:105686564-105686586 TCCCATGTCCAGGAAGAATGAGG + Intergenic
912079258 1:105914321-105914343 TCCGGTGTCCAGGAAAAATGAGG - Intergenic
912132593 1:106620368-106620390 TCCTGCGACCAGGAAGAATGAGG - Intergenic
912943007 1:114061440-114061462 TCTTGAGTCCAGGAAGAATGAGG - Intergenic
913454734 1:119019378-119019400 CCCAGTGTCCTGGAAGAATCAGG - Intergenic
914743617 1:150485360-150485382 TCCTGTGTCCTAGATGTATCAGG + Intergenic
915637482 1:157196597-157196619 TCTTGCATCCAGGAAGAATGAGG - Intergenic
915751373 1:158213643-158213665 TCCTGCAACCAGGAAGAATGAGG - Intergenic
916205829 1:162315431-162315453 TCTTGTGTCCTGGCACAATTGGG + Intronic
916501362 1:165390228-165390250 CCATGGGTCCTGGAAGCATGTGG - Intergenic
916648768 1:166816133-166816155 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
916731810 1:167573312-167573334 ACATGTGCACTGGAAGAATGGGG + Intergenic
917210056 1:172622046-172622068 GCCTGTGCACTGGGAGAATGAGG + Intergenic
917237751 1:172912958-172912980 TCCCATGTCCAAGAAGAATGAGG + Intergenic
918220664 1:182433471-182433493 GCCTGTGTCCTGGGAGGCTGAGG - Intergenic
919083193 1:192891055-192891077 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
919165237 1:193884541-193884563 TCCTGCATCCAGGAGGAATGAGG + Intergenic
919168743 1:193927734-193927756 TCCCACGTCCAGGAAGAATGAGG + Intergenic
919205676 1:194419881-194419903 TCCCACGTCCAGGAAGAATGAGG + Intergenic
919262687 1:195218340-195218362 TCCCATATCCAGGAAGAATGAGG - Intergenic
919302809 1:195791485-195791507 TCCCATGTCCAGGAAGAATGAGG - Intergenic
919314571 1:195954904-195954926 TCCGGTGTCCAGGAGAAATGAGG - Intergenic
919513380 1:198493781-198493803 TCCTGTACCCAGGAAGAGTGAGG + Intergenic
920278316 1:204824953-204824975 TCCAGTGTCCAGGAAGAATCAGG + Intergenic
920461123 1:206141232-206141254 TCCGGTGTCCAGGAAGAATCAGG - Intergenic
920529427 1:206690965-206690987 TTCTGTGTCCTGGAGGGAGGTGG + Intronic
920921181 1:210298528-210298550 TCCAGTGTCCAGGAAGAATCAGG + Intergenic
921520950 1:216153170-216153192 TCCGGTGTCCAAGAAGAATCAGG - Intronic
921625448 1:217373609-217373631 TCCTATGTTCAGGAAGAATGAGG - Intergenic
921675292 1:217969189-217969211 TCCCATGTCCAGGAAGAATGAGG - Intergenic
921680034 1:218020530-218020552 TCCAGTGTCCAGGAAAAATGAGG - Intergenic
921705931 1:218323280-218323302 TGCTGCATCCAGGAAGAATGAGG + Intronic
922032207 1:221812385-221812407 CCCTGTGTCCTGGAAGTAGATGG - Intergenic
922041629 1:221903506-221903528 TCTTATGACCAGGAAGAATGAGG + Intergenic
922132802 1:222795912-222795934 TCCTGTGACGAGGAAGAATGAGG - Intergenic
922141628 1:222893876-222893898 TCCCGTGTCCAGGAATAATGAGG + Intronic
922334054 1:224604826-224604848 TACTGTGCCCAGGAAGAATGAGG + Intronic
923347201 1:233066185-233066207 TCCTGTGTCTGAGAAGAATGAGG - Intronic
923755344 1:236786267-236786289 TCCTGCATCCAGGAAGAATGAGG - Intergenic
923786132 1:237071055-237071077 TCCAGCGTCTGGGAAGAATGAGG + Intronic
923917909 1:238529856-238529878 TCCCATGTCTAGGAAGAATGAGG + Intergenic
924404653 1:243730368-243730390 TCCTTTGTCCAGGAAGAATGAGG - Intronic
924467533 1:244312030-244312052 TCTGGTGTCCAGGAAGAATCAGG + Intergenic
924673109 1:246148502-246148524 TCCTGTGTCCAGGAAGAATGAGG - Intronic
924679991 1:246221342-246221364 TCCTGTGACCAGGAAGAATGAGG - Intronic
924838676 1:247683509-247683531 TCTTGTGTTCTTGAAAAATGTGG - Intergenic
1062769998 10:91854-91876 TCCTGTGTCCAGGAAGAATGTGG + Intergenic
1063099093 10:2934380-2934402 TTCTGTGTCCTGGCAGTGTGGGG - Intergenic
1063106200 10:2994766-2994788 TCCTGTGGTCTAAAAGAATGTGG + Intergenic
1063248755 10:4251393-4251415 ACCTCTGACCAGGAAGAATGAGG - Intergenic
1063374945 10:5548669-5548691 TCCTGGGTTCTGGGAGGATGAGG - Intergenic
1064428958 10:15255013-15255035 CTCTGTGTCCTGCATGAATGGGG - Intronic
1064599743 10:16981407-16981429 TCCAGTGTCCAGGAAGAATCAGG - Intronic
1065009360 10:21407617-21407639 TTCAGTGTCCAGGAAGAATCAGG + Intergenic
1065216924 10:23458091-23458113 TCCTGTGTATAGGAACAATGGGG + Intergenic
1065304344 10:24354532-24354554 TCCTGCATCCAGGAAGAATCAGG + Intronic
1065830364 10:29609159-29609181 TCCTGTGTCTAGGAAGAATGAGG - Intronic
1065976600 10:30847500-30847522 TCCTGCGTTCAGGAAGAATGAGG - Intronic
1066101489 10:32122206-32122228 TCCTGGGACCAAGAAGAATGAGG + Intergenic
1066251491 10:33637380-33637402 TCCTGTGTCCAGGAAGAATCAGG - Intergenic
1066281003 10:33918355-33918377 TTCGGTGTCCAGGAAGAATTGGG + Intergenic
1067018091 10:42772425-42772447 TCCCGCATCCAGGAAGAATGAGG - Intergenic
1067258658 10:44666956-44666978 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1067715777 10:48690450-48690472 TCCTGCATCCAGTAAGAATGAGG + Intronic
1067897644 10:50201252-50201274 TCCAGTGTCTAGGAAGAATCAGG - Intronic
1068060547 10:52063583-52063605 ACCTGTGACCGGGAAGAATGTGG + Intronic
1068083644 10:52348065-52348087 TCCTATGACCAGGAAGAATGAGG - Intergenic
1068130545 10:52890069-52890091 TCCTGCGTCCAGGGAGAATGAGG - Intergenic
1068157632 10:53222353-53222375 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1068279834 10:54854420-54854442 TCCTGTGCCCAGGAAGAATGAGG + Intronic
1068283609 10:54908618-54908640 TCCTGCATCCAGGAAGAAAGAGG + Intronic
1068348516 10:55814116-55814138 TCCTGCCTCCAGGAAGAATGAGG - Intergenic
1068418887 10:56763158-56763180 TCCCATGTCCAAGAAGAATGAGG - Intergenic
1068443948 10:57095936-57095958 TCCCTCGTCCAGGAAGAATGAGG - Intergenic
1068474484 10:57507562-57507584 TCCCATATCCAGGAAGAATGAGG - Intergenic
1069003995 10:63297480-63297502 TCCTGCATCCAGGAAGAATGAGG - Intronic
1069038831 10:63673219-63673241 TCCGGAGTCCAGGAAGAATCCGG - Intergenic
1069121861 10:64577309-64577331 TCTTGTGTCCTGAAAGGCTGAGG - Intergenic
1069156323 10:65035056-65035078 TCCCATGACCAGGAAGAATGAGG - Intergenic
1069156657 10:65038052-65038074 TCCTGCATCCAAGAAGAATGAGG - Intergenic
1069198282 10:65581624-65581646 TCCCGTGTCCAAGAAGAATGAGG - Intergenic
1069561727 10:69435520-69435542 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1069593013 10:69653469-69653491 CCCTGTGTCCAGGAAGAATGAGG - Intergenic
1070428833 10:76316023-76316045 TCCTGCATCCAGGAAGAATGAGG - Intronic
1070706082 10:78639857-78639879 TTCTGTGCCCTGGCAGACTGTGG + Intergenic
1070766665 10:79060722-79060744 TCCTGTCTCCTGGCAGCATTTGG + Intergenic
1070864465 10:79698972-79698994 TTCTGTGTCTTGGAAGATGGAGG - Intergenic
1071060836 10:81569963-81569985 CCTTGTGACCAGGAAGAATGAGG + Intergenic
1071149757 10:82620311-82620333 TCCAGCGTCCAAGAAGAATGAGG + Intronic
1071399149 10:85252605-85252627 GTCTGTGTCCTTGAAGAAGGGGG - Intergenic
1071631364 10:87221202-87221224 TTCTGTGTCTTGGAAGATGGAGG - Intergenic
1071885984 10:89951328-89951350 TCCTGTGCCCAGGAAGAATGAGG + Intergenic
1071940332 10:90584523-90584545 TTCTGTGTTGTTGAAGAATGTGG - Intergenic
1072154672 10:92714196-92714218 TCTTGTGTCCAGGAAGAATGAGG + Intergenic
1072199367 10:93144737-93144759 TACTGTGCCCAAGAAGAATGAGG - Intergenic
1072208633 10:93226197-93226219 TCTGGTGTCCAGGAAAAATGAGG + Intergenic
1072335488 10:94394807-94394829 TCTTGTGTGCAGGAAGAATGAGG + Intergenic
1072357397 10:94624792-94624814 CCCAGTGTCCTGAAAGAATTGGG - Intergenic
1072470143 10:95706311-95706333 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
1072871241 10:99123611-99123633 TCCTGTGTCCAGGAATAATGAGG + Intronic
1073148954 10:101298737-101298759 TCCTGGGTCCTGGAACATGGTGG + Intergenic
1073260661 10:102188031-102188053 TCCTGCGTTCAGGAAGAATGAGG + Intergenic
1073623282 10:105071112-105071134 TCCTGTTTCCAGGAATCATGTGG + Intronic
1073670207 10:105579603-105579625 TCCTGTGCCCATGAAGAATGAGG + Intergenic
1073735094 10:106336366-106336388 TCCGGTGTCCAGGAAGAATCAGG - Intergenic
1073790830 10:106938584-106938606 TCCTGTCACCAGGAAGCATGTGG - Intronic
1074028847 10:109664321-109664343 TCCTGTGACCAGGAAGAAAAAGG - Intergenic
1074106664 10:110394101-110394123 TCCTGCCTCCGGGAAGCATGGGG - Intergenic
1074134952 10:110618135-110618157 TCCTGTGGACTGGAAGGAGGAGG + Intergenic
1074203883 10:111264442-111264464 TCCTGTCACTTGGGAGAATGTGG - Intergenic
1074247887 10:111713311-111713333 TCCTGTGTCCAGGAACAATGAGG + Intergenic
1074412982 10:113243803-113243825 TCCTTTCTCCTGGAAGAAGAGGG - Intergenic
1074979587 10:118608854-118608876 TCCCATGTCCAGGAAGAATGAGG + Intergenic
1075007896 10:118843580-118843602 CCCTGTGACCAGGAAGAATGAGG - Intergenic
1075125424 10:119695202-119695224 TCATGCATCCAGGAAGAATGAGG + Intergenic
1075132032 10:119748471-119748493 TCCCGTGTCCAGGAAGAATGAGG + Intronic
1075779891 10:125010587-125010609 TCCTGGCTTCAGGAAGAATGTGG - Intronic
1075848691 10:125568162-125568184 CCCAGCGTCCAGGAAGAATGAGG - Intergenic
1075937405 10:126354380-126354402 TCCTGTGTTCTGGAAGTAGGGGG + Intronic
1076102534 10:127794491-127794513 TCCAGTGTCCAGAAAGAATCAGG - Intergenic
1076549085 10:131266536-131266558 TCTTGAGTCCAGAAAGAATGAGG + Intronic
1076615287 10:131750742-131750764 GCCTGTGTCCAGGAAGTCTGGGG + Intergenic
1076655106 10:132018864-132018886 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1077012876 11:386730-386752 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1077275719 11:1706688-1706710 TCCAGCGTCCAAGAAGAATGAGG - Intergenic
1077912764 11:6587347-6587369 TCCTGCGACCAGGAAGAATGAGG - Intronic
1078042707 11:7883535-7883557 TCCTATGTCCAGAAAGAATGAGG + Intergenic
1078315103 11:10288266-10288288 TTCTGTGACCAGGAAGAATGAGG + Intronic
1078415420 11:11160820-11160842 TCCTGTACCCAAGAAGAATGAGG - Intergenic
1078836353 11:15034567-15034589 TCCTGCATCCTGGAAGAATGAGG + Intronic
1079213617 11:18486204-18486226 TCCTGTGCCCACAAAGAATGGGG - Intronic
1079472246 11:20789639-20789661 TCCTGCAACCAGGAAGAATGAGG + Intronic
1079674085 11:23203010-23203032 TCCCATGTCCAGGAAGAATGAGG - Intergenic
1079733305 11:23962599-23962621 TCCTGCGTCCAGGAGGAATGAGG - Intergenic
1079983282 11:27174457-27174479 GCCTGTGACCCTGAAGAATGAGG - Intergenic
1080134381 11:28837326-28837348 TTCTGTGTCCTGATAGAGTGGGG - Intergenic
1080193202 11:29576104-29576126 ACCTGTGGCTTTGAAGAATGGGG - Intergenic
1080333982 11:31174918-31174940 AACTGTGTCCAGGAAGGATGAGG - Intronic
1080356854 11:31458765-31458787 TCCTGTAACCTGGATGAATAGGG + Intronic
1080485765 11:32704954-32704976 TCCCATGTCCAGGAAGAATGAGG - Intronic
1080502681 11:32885569-32885591 TCCAGCGTCCCAGAAGAATGAGG - Intergenic
1080583910 11:33665174-33665196 TCCTGGGTCCAGGAAGAATAAGG + Intronic
1080851938 11:36077911-36077933 TCCTGCATCCGGGAAGAATGAGG + Intronic
1080966946 11:37224394-37224416 TCCCATGTCCAGGAAGAATGTGG + Intergenic
1081010942 11:37811956-37811978 TATGGTGTCCAGGAAGAATGAGG + Intergenic
1081062891 11:38503091-38503113 TCCAGTGTTCTGGAAGAATCAGG + Intergenic
1081109858 11:39121388-39121410 TCCAGCGTCCAAGAAGAATGAGG + Intergenic
1081131136 11:39381614-39381636 TCTGGTGTCCAGGAAAAATGAGG + Intergenic
1081268654 11:41058020-41058042 TCCTGTGAAAAGGAAGAATGAGG - Intronic
1081283955 11:41245748-41245770 TCCTGCATCCAGGAAGAATGAGG + Intronic
1081312565 11:41592037-41592059 TCCAGTGTCCTAGAAGAATCAGG + Intergenic
1081463076 11:43289479-43289501 TCCTGGATCCAAGAAGAATGAGG - Intergenic
1081650855 11:44823271-44823293 TCCTGTGTCCAAGAAGAATGAGG + Intronic
1082661726 11:55920325-55920347 TCCTGCCTCCAGGAAGATTGAGG - Intergenic
1082701177 11:56433134-56433156 TCCTATGTCCAGGAAGAATGAGG + Intergenic
1082750049 11:57005619-57005641 TCCTGTGACCAGGAAGAATCTGG + Intergenic
1083066721 11:59931667-59931689 TCCTATGTTGAGGAAGAATGAGG + Intergenic
1083140700 11:60718825-60718847 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1084136626 11:67188176-67188198 CCCTGTGTCTTGAAAGAAAGAGG + Intronic
1084398555 11:68930663-68930685 TCCTGCATCCAGGAAGAATGAGG + Intronic
1084875001 11:72124541-72124563 GCCAGTGTCCAAGAAGAATGAGG + Intronic
1084991196 11:72926692-72926714 TCCTGTGTCCTGGAAGTATGCGG - Intronic
1085146502 11:74203721-74203743 TCCTCAGCCCTGGAAGAAAGCGG + Exonic
1085212135 11:74791006-74791028 TCCTGTGTCCAGAAAGAAAGAGG + Intronic
1085453857 11:76654990-76655012 TTCTGAGTCCTGGAAGACAGGGG + Intergenic
1085496938 11:76978568-76978590 TCCTGCATCCAGGAAGAATGAGG - Intronic
1086084704 11:82942912-82942934 TCCTGCGCCCTGGAAGAATAAGG + Intronic
1086092833 11:83021190-83021212 TCCTATGACCAGGAAGAATGAGG - Intronic
1086493403 11:87377967-87377989 TCCGGTGTCCAAGAAGAATGAGG + Intergenic
1086508247 11:87528299-87528321 TCCTGTGTCCAGGAAGAATGTGG + Intergenic
1087009098 11:93496665-93496687 TCATGTGTCCTGGCTGAGTGGGG - Intronic
1087037841 11:93772623-93772645 TCCTGCAACCAGGAAGAATGAGG + Intronic
1087338866 11:96877866-96877888 ACCAGTGTCCAGGAAAAATGAGG + Intergenic
1087392372 11:97553774-97553796 TCCTTTATCCTGAAAGAATGAGG + Intergenic
1087442839 11:98207923-98207945 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1087534347 11:99424841-99424863 TTCTATGTCCAGGAAGAATGAGG + Intronic
1087602963 11:100339264-100339286 TCTGGTGTCCAAGAAGAATGAGG + Intronic
1088135716 11:106553092-106553114 TCCTGGGACCAGGAAGAACGAGG - Intergenic
1088228711 11:107650641-107650663 ACCAGTGTCCAGGAAGACTGAGG + Intronic
1088287911 11:108206758-108206780 TCCTGCGTCCAGGAAGAATGAGG + Intronic
1088328774 11:108628871-108628893 TCCTGTGTCCAAGAAGAATGAGG + Intergenic
1088448281 11:109955242-109955264 TCTGGTGTCCAGGAAGAATTGGG - Intergenic
1088513357 11:110600102-110600124 TCCTGTGACCAGGAAGAATGAGG - Intronic
1088651195 11:111959097-111959119 CCCTGCATCCAGGAAGAATGAGG - Intronic
1088704211 11:112447399-112447421 TCCTGCATCCAAGAAGAATGAGG + Intergenic
1088715316 11:112543855-112543877 TCCAATGTCCAGGAAAAATGAGG + Intergenic
1089031028 11:115329710-115329732 TCCAGTGTCCAAGAAGAATCAGG + Intronic
1089309772 11:117550377-117550399 GCCTCTGTCCTGAAGGAATGTGG - Intronic
1089320403 11:117622588-117622610 TCCAGAGTCCTGGAGGAAGGGGG + Intronic
1089591955 11:119547318-119547340 TCCTGTGACCAGGAAGAATGGGG - Intergenic
1089849778 11:121486235-121486257 TCCCTGCTCCTGGAAGAATGAGG - Intronic
1089924392 11:122242361-122242383 TCCTCGGTCCTGTGAGAATGTGG + Intergenic
1090116561 11:123979688-123979710 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
1090150009 11:124374210-124374232 TCCTGTGTCCAAGAAGAACGAGG + Intergenic
1090245233 11:125211599-125211621 AGCTGAGCCCTGGAAGAATGTGG + Intronic
1090293453 11:125566573-125566595 TCCAGTGTCCAAGAAGAATGAGG + Intergenic
1090514568 11:127411752-127411774 TCCTGTGACCAGGAAGAATGAGG + Intergenic
1090910084 11:131111106-131111128 TCCCATGTCCAGGAAGAATGAGG + Intergenic
1091166190 11:133478309-133478331 TTCTCTGTACTGGAAGAAGGAGG - Intronic
1091700331 12:2654836-2654858 TCCTGTGTCCTGTCAGAAGCAGG + Intronic
1091712420 12:2751469-2751491 TCCTCTGTACTGGAAGGCTGTGG - Intergenic
1092492233 12:8956117-8956139 TCCTGCGTCCAAGAAGAATGAGG - Intronic
1092563047 12:9636852-9636874 TCCTGTGCACTGGGAGGATGGGG - Intergenic
1092618523 12:10237433-10237455 TCCAGCGTCCAAGAAGAATGAGG - Intergenic
1092795638 12:12107923-12107945 TCCTGCATCCAAGAAGAATGAGG + Intronic
1093281868 12:17204589-17204611 TCCTGTCACCAGGAAGAATGAGG - Intergenic
1093298047 12:17416314-17416336 TCCCATGTCCAGGAAGAATGAGG - Intergenic
1093317168 12:17666352-17666374 TCCAGCGTCTAGGAAGAATGAGG + Intergenic
1093492941 12:19725636-19725658 TCCTGTGACCAGGAAGAATGAGG + Intergenic
1093592318 12:20917574-20917596 TCTGGTGTCCAAGAAGAATGAGG + Intergenic
1093764916 12:22952214-22952236 TCCTGTATCCAGGAAGAATGAGG + Intergenic
1094018141 12:25885355-25885377 TCCTGCATCCAGGAATAATGAGG - Intergenic
1094436432 12:30425299-30425321 TCCAGAGTCCTGGAAGAATCAGG - Intergenic
1094745586 12:33341130-33341152 TCCAGTGTCCAGGAAGAATCAGG + Intergenic
1095145490 12:38721559-38721581 TCCTATAGCCAGGAAGAATGAGG - Intronic
1095444032 12:42267279-42267301 TCCTGTGTCTAGGAAGAATGAGG + Intronic
1095603266 12:44038087-44038109 TCCTGTGTCCAGGAAAAATGAGG - Intronic
1095727556 12:45469887-45469909 TCTTGTGTCCAGGAAGAATGAGG - Intergenic
1096170220 12:49462590-49462612 TCTGGTGTCCAGGAAAAATGAGG + Intronic
1096355473 12:50937637-50937659 TTCCGTGTCCTGGAACAATGAGG + Intergenic
1096602935 12:52743006-52743028 TCCTGTGTCCAGGAAGAGATAGG - Intergenic
1097026357 12:56058687-56058709 CCCTGTGACTTGGAAGACTGAGG + Intergenic
1097052395 12:56231190-56231212 GACTGTGCCCTGGAAGAATGAGG - Exonic
1097129893 12:56804279-56804301 TCCTGTGACCAGGAAGAATGAGG + Intergenic
1097130810 12:56809624-56809646 TACTGAGACCAGGAAGAATGAGG + Intergenic
1097140689 12:56900393-56900415 TCCTGCAACCAGGAAGAATGAGG - Intergenic
1097290847 12:57913745-57913767 TCCAGTGTCCCGGAAGAATCAGG - Intergenic
1097360744 12:58655860-58655882 TCCCATGTCCAGGAAGAATGAGG + Intronic
1097446441 12:59678292-59678314 TCCTGTGTCCAGGAAGAATGAGG + Intronic
1097500307 12:60392891-60392913 TCCTACATCCAGGAAGAATGAGG - Intergenic
1097536121 12:60872772-60872794 CCCTGCGTCTAGGAAGAATGAGG + Intergenic
1097747838 12:63318743-63318765 TCCAGTGACCAGGAAGAATGAGG + Intergenic
1098465575 12:70783123-70783145 TCCTGCATTCAGGAAGAATGAGG + Intronic
1098554648 12:71804529-71804551 TCCAGCGTCCAGGAAGAATCAGG - Intergenic
1098597782 12:72294258-72294280 TCCTGTGACCAGGAAGAATGAGG + Intronic
1098702414 12:73645744-73645766 TCCCATGTCCAAGAAGAATGAGG + Intergenic
1098753136 12:74321693-74321715 TTCTGTGTCCAAGAAGAATGAGG + Intergenic
1098768052 12:74514799-74514821 TCATGTGACCAAGAAGAATGAGG + Intergenic
1098790621 12:74817305-74817327 TCCCATGTCCAGGGAGAATGAGG - Intergenic
1098802938 12:74985168-74985190 TCCAGTGCCCAGGAAAAATGAGG + Intergenic
1098951652 12:76645747-76645769 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1099295458 12:80823149-80823171 TCCTATGTCCAGGAAGAATGAGG - Intronic
1099368157 12:81795635-81795657 TACTGTGCCCAAGAAGAATGAGG - Intergenic
1099401675 12:82209382-82209404 TCCTGTGTCCAAAAAGAATGAGG - Intergenic
1099517589 12:83616761-83616783 TCCTTTTTCCTGGAACAAGGAGG + Intergenic
1099557628 12:84129120-84129142 TTCCGTGTCCAGGAAGAATGAGG - Intergenic
1099574633 12:84363245-84363267 TCCTGAGACCAGGGAGAATGAGG - Intergenic
1099682382 12:85844688-85844710 TCCTGCCTCCAAGAAGAATGAGG - Intergenic
1099683327 12:85856241-85856263 TCCTGCATCCAGAAAGAATGAGG + Intergenic
1099693402 12:85991015-85991037 TCCTGCATCGAGGAAGAATGAGG + Intronic
1100131730 12:91502651-91502673 CCCAGAGTCCTGGAAGAATTGGG + Intergenic
1100722068 12:97369737-97369759 TCCTGTGTCTTGCTAGAATGTGG - Intergenic
1101451215 12:104780758-104780780 TCCTATGACCAAGAAGAATGAGG + Intergenic
1101473216 12:105018832-105018854 TCCAGCGTCCAGGAGGAATGAGG + Intronic
1101550242 12:105754704-105754726 TCCGGTGTCCAGGAAGAATCAGG + Intergenic
1101763932 12:107681791-107681813 TCCTGAGTCCAGGACGAATGGGG + Intergenic
1102000748 12:109556789-109556811 TCCTGGGTCTTGGAGGGATGTGG - Exonic
1102060536 12:109927625-109927647 TCCTGCATCCTGGAAGAATGAGG - Intronic
1102517239 12:113457983-113458005 TCCTGGGTCCAGGGACAATGTGG + Intergenic
1102795923 12:115688728-115688750 TCCCATGTCCTGGATGAAGGTGG - Intergenic
1103194453 12:119030138-119030160 ACATGTGTGCTGAAAGAATGTGG - Intronic
1103564525 12:121808760-121808782 CCCTGTGTCCTGGAAGGCAGTGG - Intronic
1103954740 12:124569618-124569640 TCCTGTTTCCTGGCTGAATTGGG + Intergenic
1104096792 12:125565510-125565532 TCCAGTATCCAGGAAGAATCAGG + Intronic
1104219359 12:126767184-126767206 TCCTGTGTCCAAGAAGAATGAGG - Intergenic
1104285160 12:127418344-127418366 TCCAGTGCCCAAGAAGAATGAGG - Intergenic
1104320804 12:127749114-127749136 TCATGTGTCCTGGGACAATTAGG + Intergenic
1104805600 12:131587400-131587422 TTCTGTGACCAGGAAGAATGAGG - Intergenic
1105041934 12:132967536-132967558 TCCTGCGACCAGGAAGAAAGAGG - Intergenic
1105245997 13:18650786-18650808 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
1105348568 13:19596383-19596405 CCCAGTGGCCTGTAAGAATGAGG - Intergenic
1105424524 13:20283231-20283253 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1105479112 13:20757018-20757040 TACTGCGTCCAAGAAGAATGAGG - Intronic
1105972967 13:25447738-25447760 TCCAGTGTCCAGGAAGAATCAGG + Intronic
1106253460 13:28001534-28001556 TCCAGTGTCCAGGAAGAATGAGG + Intergenic
1106379608 13:29223625-29223647 TCCCATGTCCAGGAAGAATGAGG - Intronic
1106576268 13:30978713-30978735 TCCTGCATCCAGGAAGAGTGAGG + Intergenic
1106823325 13:33490713-33490735 TCCAGTGTCCCGGAAAAATTGGG - Intergenic
1106942311 13:34792401-34792423 TCCAATGTCCAGGAGGAATGAGG - Intergenic
1107147112 13:37070773-37070795 TCTTGTGACCAGGAAGAATGAGG - Intergenic
1107171018 13:37341978-37342000 TCCCGTGTCCAGAAAGAATAAGG - Intergenic
1107229102 13:38086674-38086696 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1107356345 13:39571582-39571604 TCCGGCATCCAGGAAGAATGAGG - Intronic
1107513679 13:41108575-41108597 TCCTGTATCCAGGAAGAATGAGG - Intergenic
1107841216 13:44459503-44459525 TCTCGTGTCCAGGAAGAATGAGG - Intronic
1107853523 13:44592566-44592588 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1107871313 13:44749083-44749105 TCCTGTCACCTGAAGGAATGAGG - Intergenic
1107875759 13:44789466-44789488 TCCTGCATCCAGGAAGAATAAGG + Intergenic
1108088343 13:46818866-46818888 TCCTACGTCCTGGAAGAATGAGG - Intergenic
1108159075 13:47618990-47619012 TCAGGTGTCCAGGAAGAATCAGG - Intergenic
1108240271 13:48457079-48457101 TCCTGCAGCCAGGAAGAATGAGG + Intronic
1108249654 13:48551559-48551581 TCCCATGTCCAGGAAGAATGAGG - Intergenic
1108254664 13:48598645-48598667 TCCAGTGTCCAGGAAAAATAAGG - Intergenic
1108559362 13:51627700-51627722 TCCCATGTCCAGGAAGAATGAGG + Intronic
1108787404 13:53921417-53921439 TTCTGTGACCAGGAGGAATGAGG + Intergenic
1108826310 13:54416381-54416403 TCCTGCATCCAAGAAGAATGAGG + Intergenic
1108847067 13:54691655-54691677 TTCCATGTCCAGGAAGAATGAGG + Intergenic
1108849349 13:54708010-54708032 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1108958501 13:56189920-56189942 TCCAGTGTCCAGGAGGAATAAGG - Intergenic
1109006710 13:56886460-56886482 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
1109029954 13:57179059-57179081 TCTTGTGTGCAGGAAGAATAAGG + Intergenic
1109396441 13:61765895-61765917 TCCCGCGTCCGGGAAGAGTGAGG + Intergenic
1109422993 13:62137846-62137868 TCATGTGCCCAAGAAGAATGAGG - Intergenic
1109426280 13:62168749-62168771 TCCTGCATGCAGGAAGAATGAGG - Intergenic
1109562796 13:64075506-64075528 TCCTGTGTCCAGGATGAATGAGG + Intergenic
1109572171 13:64207002-64207024 TCCCATGTCCAAGAAGAATGGGG + Intergenic
1109589774 13:64462988-64463010 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
1109719741 13:66260453-66260475 TCCGGTGTCCGGGAAAAATCAGG + Intergenic
1109738614 13:66520837-66520859 TCCTCTGTCCTGGAAGACAAGGG - Intronic
1109780826 13:67107680-67107702 TCTCATGTCCAGGAAGAATGAGG - Intronic
1109801115 13:67380007-67380029 TCCAGTGTCTTGGAAAAATCAGG - Intergenic
1109915786 13:68983632-68983654 TCTTGTGTCCAGGAGGAATGAGG + Intergenic
1109944850 13:69420273-69420295 TCCAGTGTCCAGGAAGAATGAGG + Intergenic
1109982330 13:69924605-69924627 TCCCGTGCCCAGGAAGAAGGAGG - Intronic
1109988168 13:70017119-70017141 TCCTATGTCCAGGAGGAATGAGG - Intronic
1110008245 13:70298018-70298040 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1110439083 13:75507672-75507694 TCCCAAGTCCAGGAAGAATGAGG + Intergenic
1110670190 13:78168855-78168877 TCCTACATCCAGGAAGAATGAGG + Intergenic
1110939504 13:81331183-81331205 TCCTGTGTCCAGGAAGAATAAGG - Intergenic
1110980371 13:81889826-81889848 TCCAATGTGCAGGAAGAATGAGG - Intergenic
1110999646 13:82163921-82163943 TTCTGTGTCCAGGAAGAATGAGG + Intergenic
1111005312 13:82240083-82240105 TCCTGTGACCAAGAGGAATGAGG - Intergenic
1111028920 13:82570351-82570373 CCCTGTGTCCAAGAAGAATGAGG + Intergenic
1111079248 13:83280074-83280096 ACATGTGCACTGGAAGAATGGGG + Intergenic
1111141612 13:84127095-84127117 GCCAGTGTCCAAGAAGAATGAGG + Intergenic
1111243786 13:85508685-85508707 GCCTGAATCCAGGAAGAATGGGG - Intergenic
1111268886 13:85854140-85854162 TCCCATGTCCAGGAAGAATGAGG - Intergenic
1111274935 13:85936029-85936051 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1111466733 13:88622861-88622883 TCCTATGACCAAGAAGAATGAGG - Intergenic
1111474391 13:88725899-88725921 TCCTGCATCCAGGAAGAATGCGG - Intergenic
1111485057 13:88887146-88887168 CCCAGTATCCAGGAAGAATGAGG - Intergenic
1111487745 13:88926566-88926588 TCTTGTGTCCAGGAAGAACGAGG + Intergenic
1111595445 13:90404555-90404577 TCCCATGTCCAGGAATAATGAGG - Intergenic
1111605441 13:90532760-90532782 TTCTTTTTCCTGGCAGAATGAGG + Intergenic
1111607867 13:90564016-90564038 TCTGGTGTCCAGGAAGAATTAGG - Intergenic
1111800413 13:92974379-92974401 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
1112261491 13:97881946-97881968 TCTGGTGTCCAGGAAGAATCAGG + Intergenic
1112547154 13:100382127-100382149 TCTGGTGTCCAGGAAAAATGAGG + Intronic
1113055087 13:106259382-106259404 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
1113229352 13:108195334-108195356 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1113338695 13:109401432-109401454 GCCTGCGCCCTGGGAGAATGGGG + Intergenic
1113748206 13:112760842-112760864 TCCTGTGGACTGAAGGAATGAGG - Intronic
1113970753 13:114186423-114186445 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1114281108 14:21192992-21193014 TCCTGTGACCAGGAAGAATGAGG - Intergenic
1114349516 14:21835197-21835219 TCCTGCAACCAGGAAGAATGAGG + Intergenic
1114374007 14:22123510-22123532 TCATTTGTCCTTGAAGTATGAGG + Intergenic
1114980465 14:28157879-28157901 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1115059161 14:29169164-29169186 TCCCGTATCCAGGAAGAATGAGG - Intergenic
1115153746 14:30315034-30315056 TCCTGCATCCAGGAAAAATGAGG - Intergenic
1115310531 14:31974350-31974372 TCCCGTGTCCAGGAAGAATGAGG + Intergenic
1115366926 14:32568580-32568602 TCCAGTGTCTTGGAGGATTGGGG + Intronic
1116019336 14:39441773-39441795 TCCCATGTCCATGAAGAATGAGG - Intergenic
1116035944 14:39627184-39627206 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
1116130907 14:40854926-40854948 TCCTGCATCCAGGAAAAATGAGG - Intergenic
1116151225 14:41144983-41145005 TCCATTGTCCAGGAAGAATGAGG + Intergenic
1116221635 14:42095675-42095697 TCCTGTATCCAGGAAGAATGAGG + Intergenic
1116257283 14:42571852-42571874 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
1116313710 14:43359890-43359912 TCATGTGTCCAGGAAAAATGAGG + Intergenic
1116356796 14:43939604-43939626 ACCTGCATCCGGGAAGAATGAGG - Intergenic
1116396423 14:44452613-44452635 TGCAGTGTCCAGGAGGAATGAGG + Intergenic
1116448462 14:45038808-45038830 TCCTGAGTCCAAGAAGAATTAGG + Intronic
1116523817 14:45880539-45880561 TCTGGTGTCCAGGAAGAATGAGG - Intergenic
1116789942 14:49329588-49329610 TCTTGCATCCAGGAAGAATGAGG + Intergenic
1116918664 14:50549479-50549501 TCCTGTGCCCTGGAATGGTGGGG + Intronic
1116961707 14:50973804-50973826 TCCTGTATCCAGGAAGAGTGAGG - Intergenic
1117084758 14:52188084-52188106 TCTAGTGTCCAAGAAGAATGAGG - Intergenic
1117285435 14:54282253-54282275 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1117450546 14:55845613-55845635 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
1117734071 14:58751638-58751660 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1117944017 14:60998578-60998600 TCCTGTGTCCAGGAAGAATCAGG - Intronic
1118200048 14:63663330-63663352 TCCTGTGTCCAGAAAGAATGAGG + Intergenic
1118213484 14:63787495-63787517 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1119036255 14:71232318-71232340 TCCTGTGTCCAGGAGGAATGAGG - Intergenic
1119137938 14:72237976-72237998 TCTGGTGTCCAGGAAGAATCAGG + Intronic
1119159015 14:72437767-72437789 CCCAGTGTGCTGGAAGACTGCGG - Intronic
1119213540 14:72850612-72850634 ACCTGTGTGTTGAAAGAATGAGG - Intronic
1119287218 14:73465222-73465244 GCCTGTGGCCAGGAAAAATGAGG + Intergenic
1119913331 14:78371464-78371486 TCCAGTGTCCAGGAAGAATCAGG - Intronic
1120405789 14:84091816-84091838 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1120590091 14:86364520-86364542 TCCTGTTTCCAGGAATAATGAGG - Intergenic
1120918432 14:89730947-89730969 TCCTGTGTGCTAGAAGTCTGTGG - Intergenic
1120942090 14:89958342-89958364 TCCTGCGTCCAAGAATAATGAGG + Intronic
1121014436 14:90539677-90539699 CCCTGTGTCCTGGAAAGGTGGGG + Exonic
1121527978 14:94632754-94632776 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1121553300 14:94818705-94818727 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
1121644550 14:95508896-95508918 TCCTGTGTCCTGGAAATATTAGG + Intergenic
1121666538 14:95676718-95676740 TCCAATGTCCAGGAAGAATCAGG - Intergenic
1121695286 14:95907551-95907573 TCCGGCATCCAGGAAGAATGAGG + Intergenic
1121974106 14:98386324-98386346 TCCTGCATCCAAGAAGAATGAGG - Intergenic
1122491309 14:102117666-102117688 TCCTGTGAACAAGAAGAATGAGG - Intronic
1202840247 14_GL000009v2_random:114676-114698 TCCTGAGTCCAGGAAAAATGAGG - Intergenic
1202909630 14_GL000194v1_random:104873-104895 TCCTGAGTCCAGGAAAAATGAGG - Intergenic
1202883657 14_KI270722v1_random:84429-84451 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1124650199 15:31468784-31468806 TCCTGCATCTGGGAAGAATGAGG + Intergenic
1124937644 15:34187398-34187420 TCCTGTGTCCAGGAAGAATGAGG - Intronic
1125050201 15:35288673-35288695 TGCATTGTCCTGGAAAAATGCGG - Intronic
1125238824 15:37549914-37549936 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
1125241607 15:37582733-37582755 TCCCATGTCCAGGAAGAATAAGG - Intergenic
1125381529 15:39092025-39092047 TCCTGTGATCAGGAAGAATGAGG + Intergenic
1125436093 15:39646312-39646334 TCCTGCATCCAGGAAAAATGAGG - Intronic
1125718219 15:41831807-41831829 TCCTGCATCCAGGAAGAATGAGG - Intronic
1125752426 15:42037549-42037571 TCCTGTGACCAGGAAGAACAAGG - Intronic
1125758164 15:42079751-42079773 GCCATTGTCCTGGAAGAACGAGG + Exonic
1125862124 15:43009006-43009028 TCCTGCATCCAGGAAGAATGAGG - Intronic
1125883381 15:43211508-43211530 TGCTGTGTTCCTGAAGAATGAGG - Exonic
1125886810 15:43235494-43235516 CGCTGTGTCCTGCCAGAATGGGG + Exonic
1126088340 15:45029704-45029726 TCCAGTGTCCAAGAAGAATGAGG + Intronic
1126130107 15:45332743-45332765 TCCTGCATCCAAGAAGAATGAGG - Intergenic
1126654103 15:50957153-50957175 TCTGGTGTCCAGGAAAAATGAGG + Intronic
1126979589 15:54227050-54227072 TACTTTGTCCAGGAAGAATGAGG + Intronic
1126984096 15:54282724-54282746 TCTGGTGTCCAAGAAGAATGAGG + Intronic
1127525852 15:59791609-59791631 TCCTGCAACCAGGAAGAATGAGG + Intergenic
1127904673 15:63367542-63367564 CCCTGTGTCCTAGAAGGAGGGGG + Intronic
1127965900 15:63922801-63922823 ACTGGTGTCCTGGTAGAATGTGG + Intronic
1128461297 15:67869805-67869827 TCCTGTGCCCAAGAAGAATGAGG + Intergenic
1128790647 15:70431395-70431417 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1128847921 15:70917799-70917821 TCCTGCGACCAGGAAGAATGAGG - Intronic
1129066109 15:72905318-72905340 TCCATCGTCCTGGAAGAAGGTGG + Intergenic
1129239101 15:74241182-74241204 TGCTGGGTCCTGGAAGAGGGTGG + Intronic
1129261695 15:74372148-74372170 TTCTGTGTCCTGGAGGAAAGGGG + Intergenic
1129279698 15:74474592-74474614 TCCTTAGCTCTGGAAGAATGTGG - Intergenic
1129305363 15:74657054-74657076 TCCAGTGTCCAGGAAAAATGAGG - Intronic
1129340496 15:74882707-74882729 TCCCGTGTCCAAGAAGAATGAGG + Intergenic
1129368982 15:75076187-75076209 TCCTGTGTCCAGGAAGAATGAGG + Intronic
1129377687 15:75144511-75144533 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1129785159 15:78304908-78304930 TCCTGTGTCCAGGAATAATGAGG - Intergenic
1130856064 15:87841077-87841099 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1131568274 15:93506111-93506133 TCCTACATCCAGGAAGAATGAGG + Intergenic
1131696520 15:94882667-94882689 TCCTGCATCCAAGAAGAATGAGG + Intergenic
1131737140 15:95345844-95345866 TCCTGTGACCTAGGAGAATTTGG + Intergenic
1131999185 15:98162601-98162623 TCTAGAGTCCAGGAAGAATGAGG + Intergenic
1132305381 15:100808106-100808128 CCCTGTGTCCAGGAAGAATGAGG - Intergenic
1132826935 16:1909831-1909853 CCCTGTGTCCTGGGAGTAGGAGG - Intergenic
1132971672 16:2692271-2692293 TTCTGCGTCCAGGAAGAATGAGG + Intronic
1132994319 16:2815140-2815162 TCCCTTCTCCTGGCAGAATGAGG - Intergenic
1132996709 16:2827286-2827308 TCCCTTCTCCTGGCAGAATGAGG + Intergenic
1133304021 16:4798900-4798922 TCCTGGGTGCTGGATCAATGGGG + Intronic
1133498169 16:6340026-6340048 TCCTATGTACAGGAACAATGGGG + Intronic
1133678534 16:8098651-8098673 TCCTCTCTCCAGGAAGAAAGTGG - Intergenic
1134254634 16:12601122-12601144 TCCTCCTTCCTAGAAGAATGAGG - Intergenic
1134266628 16:12698295-12698317 TTCTGTTTCCTGGAGGAATCAGG + Intronic
1134347995 16:13409308-13409330 TCCAGTGTCCTGGAAAAATTGGG - Intergenic
1134385918 16:13772311-13772333 TCATGTGTCATCTAAGAATGGGG - Intergenic
1134602315 16:15543030-15543052 TCTGGTGTCCAGGAAGAATCAGG + Intronic
1135057025 16:19240247-19240269 TCCTGCATCCAGGAAGAATGAGG + Intronic
1135257041 16:20949099-20949121 TCCAGTGTCCAGGAGGAATGGGG - Intronic
1135674863 16:24406728-24406750 TTCAGTGTCCAGGAAGAATCAGG - Intergenic
1135675566 16:24412140-24412162 TCCTGGGTCCAGGAAGACTGTGG + Intergenic
1135926831 16:26702160-26702182 TCCAGCATCCAGGAAGAATGAGG - Intergenic
1135986847 16:27190196-27190218 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
1136449184 16:30343072-30343094 TCCTGTGTCTTGGACGGATAGGG - Intergenic
1137238148 16:46632638-46632660 GTCTGTGTCCAGGAAGAATGAGG + Intergenic
1137588709 16:49680358-49680380 TCCCATGTCCAGGAAGAATGAGG - Intronic
1137698375 16:50478128-50478150 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1137815693 16:51395668-51395690 TCCAGCGTCCAGGAAAAATGAGG - Intergenic
1138689515 16:58754197-58754219 TCCTGCATCCAAGAAGAATGAGG + Intergenic
1138710909 16:58969695-58969717 TACTGTGCCCAAGAAGAATGAGG + Intergenic
1138902962 16:61296681-61296703 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
1138992669 16:62410153-62410175 TCCCGTGACCAAGAAGAATGAGG + Intergenic
1139183171 16:64771034-64771056 TCCTGTGTCTATGAAGAATGAGG - Intergenic
1139291734 16:65864566-65864588 TCCCGCGTCCAAGAAGAATGAGG - Intergenic
1139389959 16:66601237-66601259 TCTTGCATCCAGGAAGAATGAGG + Intergenic
1139463588 16:67141986-67142008 TCCTGCGGCCAGGAAGAATGAGG + Intronic
1139478866 16:67217232-67217254 GCCTGTGTCCTGGAGGCGTGCGG - Intronic
1139625763 16:68187431-68187453 TCCTGTGCCCAGGAAGAATGAGG + Intronic
1139682423 16:68575327-68575349 TCCTGCATCCAAGAAGAATGAGG + Intronic
1140103551 16:71938859-71938881 TCCTGCATCCAGGAAGAATGAGG - Intronic
1140329334 16:74038220-74038242 TCCTGTGACTTGGGAGACTGAGG + Intergenic
1140339091 16:74139698-74139720 TCCAGCATCCTGGAAGAATCGGG + Intergenic
1140419499 16:74806986-74807008 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1140703196 16:77601675-77601697 TCCAGAGTCCAAGAAGAATGAGG - Intergenic
1140805709 16:78530315-78530337 TCCAGTGTCCAGGAGGAACGAGG + Intronic
1142281344 16:89149572-89149594 TCCCGCGTCCAAGAAGAATGAGG + Intronic
1142296585 16:89227210-89227232 CCCTGTGAATTGGAAGAATGTGG + Exonic
1143833732 17:9673140-9673162 CCTTGTGTCTTGGAAGAATATGG + Intronic
1144028062 17:11296087-11296109 TCCTGCGTAGTGGAAGAAGGGGG + Intronic
1144160368 17:12551900-12551922 TCAATTGTCCTGGCAGAATGTGG - Intergenic
1144262349 17:13534610-13534632 TCCAGCATCCTGGGAGAATGAGG + Intronic
1144386324 17:14751850-14751872 TCCTGCGTTCAGGAAGAATGAGG - Intergenic
1144390024 17:14784726-14784748 TCCTGTGTCTAGGAAGAATGAGG - Intergenic
1144695542 17:17301703-17301725 TCCTGCATCCAGGAAGAATGGGG - Intergenic
1145223081 17:21105171-21105193 TCCTGCATCCAAGAAGAATGAGG - Intergenic
1146086985 17:29838826-29838848 TCCTGTGTCCAGGAAGAGTGAGG - Intronic
1146143196 17:30387869-30387891 TCCTGCATCCAGGAAGAATGAGG + Intronic
1146359237 17:32160391-32160413 TCCTGCATCCAGGAAGAATGAGG - Intronic
1146419595 17:32670895-32670917 TCCTGCATCCAAGAAGAATGAGG - Intronic
1146425362 17:32732680-32732702 TCCTGTGTCCAGGAAGAATGAGG - Intronic
1146482976 17:33219919-33219941 TCCTCTGGCAGGGAAGAATGTGG - Intronic
1146761582 17:35483333-35483355 TCCTGTGTCCAGGAAGAATGAGG - Intronic
1147515545 17:41114363-41114385 TCTTGTGTCCAGGAAAAGTGAGG - Intergenic
1147569518 17:41560051-41560073 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
1148627101 17:49078023-49078045 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1148961737 17:51398996-51399018 TCCTGTATCCTGAAAGAAGCAGG - Intergenic
1149088737 17:52751811-52751833 TCTTGTGTCCAGAAAGAATGAGG - Intergenic
1149156552 17:53637328-53637350 TCCAGTCTCCAGGAAGAAAGGGG + Intergenic
1149192075 17:54074907-54074929 TCCTGTGTCCAGGAAGTTTGTGG + Intergenic
1149256816 17:54836582-54836604 TCCCCTGTCCAGGAAGAATGAGG + Intergenic
1149316025 17:55439626-55439648 TCCTGTTTTCTGAAAGAAAGGGG - Intergenic
1149329913 17:55570185-55570207 TCCTGCAACCAGGAAGAATGAGG - Intergenic
1149482863 17:57017662-57017684 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1149563181 17:57624004-57624026 TGATGTGTCCAGGAAGAGTGGGG + Intronic
1149884732 17:60328529-60328551 TCCTGCACCCAGGAAGAATGAGG - Intronic
1150521105 17:65866900-65866922 TCCTGTGTCCAGGAAGAATGAGG - Intronic
1150737193 17:67751078-67751100 TCCCCTGTCCAAGAAGAATGAGG - Intergenic
1150868656 17:68880367-68880389 TCCCATGTCCAGGAAGAATGAGG - Intronic
1150952873 17:69822253-69822275 TCCTGTGACCATGAAGAATGAGG - Intergenic
1151018480 17:70584715-70584737 TCTGGTGTCCAAGAAGAATGAGG + Intergenic
1151395236 17:73818959-73818981 TCCCGTGTCCAGAAAGAAAGAGG + Intergenic
1151533186 17:74720800-74720822 TCAGGTGTCCAGGAAGAATCAGG + Intronic
1151635906 17:75347639-75347661 TCCTGTGTCTGAGAAGAATGAGG - Intronic
1151895208 17:76975413-76975435 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1152009066 17:77699726-77699748 TCCTGTGACCTGGTAGGATGAGG - Intergenic
1152197450 17:78925693-78925715 CCTGGTGTCCTGGAAGAACGGGG - Intergenic
1152530523 17:80916057-80916079 TCCTGCATCCAGGAAGAATGAGG - Intronic
1152856556 17:82668010-82668032 TCCTGCATCCAGGAAGAATGAGG + Intronic
1152864151 17:82712293-82712315 TCTTGCATCCAGGAAGAATGAGG + Intergenic
1153333635 18:3899886-3899908 TCCTGTGTCCTGTTAGAATTAGG + Intronic
1153411898 18:4802886-4802908 TCCAGTGTCCAGGAAAAATCAGG + Intergenic
1153724032 18:7937104-7937126 TCCTGTGTCTAGGAAGAATGAGG - Intronic
1153977835 18:10285019-10285041 TTCTGTGTCCTGCATGAATCAGG - Intergenic
1154442920 18:14408878-14408900 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
1155017855 18:21863375-21863397 TCCAGTGTTCAAGAAGAATGAGG + Intronic
1155209111 18:23586091-23586113 TCCTGTGGTCTGGAAGAGGGTGG - Intronic
1155310440 18:24517989-24518011 TCCAGTGTCCATGAAGAATGGGG + Intergenic
1155839067 18:30625469-30625491 TCTGTTGTCCTAGAAGAATGAGG + Intergenic
1156200624 18:34827506-34827528 TCCCGTTTCCTGGAGGGATGAGG + Intronic
1156327337 18:36085982-36086004 TCCTGCAACCAGGAAGAATGAGG - Intergenic
1156684375 18:39627134-39627156 TCCAGTGTCCGGGAAGAATCAGG + Intergenic
1156783675 18:40882539-40882561 TTCTGTGTCCAAGAAGAATAAGG - Intergenic
1156816441 18:41317059-41317081 TCCTGTGCCCAAGAAGAATGAGG - Intergenic
1157719660 18:49914062-49914084 TACAGGGTCCTGGAAGAATCAGG - Intronic
1157796894 18:50583056-50583078 TCCTGTGACCAAGAGGAATGAGG + Intronic
1157855421 18:51100561-51100583 TCCAGCGTCCTGAAAGAATCGGG - Intergenic
1157859210 18:51125664-51125686 TCCATTGTCCTGGAAGAATCAGG + Intergenic
1157909028 18:51597744-51597766 TCCCATGTCCAAGAAGAATGAGG + Intergenic
1158012858 18:52748690-52748712 TCCTGCATCCAAGAAGAATGAGG + Intronic
1158139392 18:54241314-54241336 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1158633054 18:59132742-59132764 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
1158774158 18:60556110-60556132 TCCTGCATCCAGGAAGAATGCGG - Intergenic
1158788078 18:60740193-60740215 TCCTGTGTCCAGGAAGAGAGAGG - Intergenic
1159186738 18:64984427-64984449 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1159431907 18:68362985-68363007 TCCTGCATCCAAGAAGAATGAGG - Intergenic
1159458598 18:68694084-68694106 TCCCGCATCCAGGAAGAATGAGG - Intronic
1159519038 18:69495366-69495388 TCCTGCATCCAGGAAGAATGAGG + Intronic
1159623906 18:70669922-70669944 TCCTGTGTCCAGGAAGAATTAGG - Intergenic
1159704843 18:71674408-71674430 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1159774234 18:72585309-72585331 TCCTGCATCCAGGAAGAATGAGG + Intronic
1159930909 18:74312068-74312090 TCCTGCATCCGGGAAGAATGAGG + Intergenic
1160083528 18:75753471-75753493 TCCCATGTCCAGAAAGAATGAGG + Intergenic
1160149474 18:76388207-76388229 TCTGGTGTCCAGGAAGAATCGGG - Intronic
1160292897 18:77609983-77610005 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
1160801714 19:973498-973520 TCCTGTCTCAGGGATGAATGTGG + Exonic
1161173147 19:2823404-2823426 TCCTGCATCCAAGAAGAATGAGG + Intronic
1161780279 19:6287102-6287124 TCCTGTGCCCAAGAAGAATGAGG - Intergenic
1161781865 19:6298235-6298257 TCCTGCGCCCAAGAAGAATGAGG - Intergenic
1161847817 19:6722012-6722034 GCCTGTAACCTGTAAGAATGAGG - Intronic
1162231667 19:9271445-9271467 TCTTGCATCCAGGAAGAATGAGG - Intergenic
1162466269 19:10842939-10842961 TCCTGCATCCAAGAAGAATGAGG + Intronic
1162799124 19:13101351-13101373 TCCCGTGTCCTGGAAGTTTCTGG - Intronic
1163313926 19:16530289-16530311 TCCGGTGTGGTGGAAGCATGAGG - Intronic
1163353710 19:16795936-16795958 TCCCGTGTCCAAGAAGAATGAGG + Intronic
1163374409 19:16921588-16921610 TCCTGAGTCCTGGGAGCTTGAGG + Intronic
1164324192 19:24178159-24178181 TCGTGAGTCCTGGAAAAAGGCGG - Intergenic
1164406777 19:27955639-27955661 GCCTGTGCACTGGGAGAATGGGG + Intergenic
1164669005 19:30062549-30062571 TGCTGTGTCCTGGGGGAATGGGG + Intergenic
1164984482 19:32638440-32638462 TCCCATGTCGAGGAAGAATGAGG - Intronic
1165000524 19:32758131-32758153 TCCTGTGTCCAAGAAGAATAAGG + Intronic
1165022709 19:32937012-32937034 TCCTGCGTCCAGGAAGAATGAGG - Intronic
1165026888 19:32968874-32968896 TCCTGCATCCAGGAAGAATGAGG + Intronic
1165139278 19:33689266-33689288 CCCTGCGACCTGGAACAATGCGG + Exonic
1165478473 19:36046652-36046674 GTTTGTGTCCCGGAAGAATGGGG - Intronic
1165638562 19:37364468-37364490 TCCTGAGTCCAAAAAGAATGAGG - Intronic
1165818809 19:38661202-38661224 GCCAGAGTCCTGGAAGCATGAGG - Intronic
1166328487 19:42065541-42065563 TCCTGGGTCCTGGGGGAAGGAGG + Intronic
1166689295 19:44813120-44813142 TCCTGGGTCCTGGGAGAGTCGGG + Intronic
1166700552 19:44879334-44879356 CCCTGCGTCCTGAGAGAATGAGG + Intronic
1166897535 19:46033277-46033299 TCCTGTGACCAGGAAGAATGAGG - Intergenic
1167013231 19:46822481-46822503 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1167215892 19:48164438-48164460 TCGTGTGTACTGAGAGAATGTGG - Intronic
1167235126 19:48309594-48309616 TACTGTGTCCAGGAAGAAGGAGG - Intronic
1167240303 19:48339404-48339426 CCCTGTGTCTTGGAAGAAAGAGG + Intronic
1167337876 19:48897681-48897703 TCCTGTGTCCTGAAGGGATGGGG - Intronic
1167346301 19:48947530-48947552 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1167711054 19:51111289-51111311 GCCTCTGTCCTGCAACAATGTGG + Intergenic
1167792413 19:51690223-51690245 TCCTGGATCCTGGAAAAAAGGGG - Intergenic
1167861978 19:52292221-52292243 TCCAGTTTCCTGGAGGAATAAGG + Exonic
1168303491 19:55420254-55420276 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
1168630155 19:57950096-57950118 TCCCACGTCCAGGAAGAATGAGG + Intergenic
1202632810 1_KI270706v1_random:15881-15903 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1202653068 1_KI270707v1_random:24168-24190 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
1202659084 1_KI270708v1_random:51577-51599 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
924963940 2:58396-58418 TCCAGCATCCAGGAAGAATGAGG - Intergenic
925262706 2:2542377-2542399 TCCTGTGTCATGGGAGATGGTGG + Intergenic
925922718 2:8647992-8648014 TCCTGTATCCAGGAAGAATGAGG - Intergenic
926070449 2:9884436-9884458 TCCTGCAACCAGGAAGAATGAGG + Intronic
926541315 2:14183588-14183610 TCCTGTGGCCAGGAAGAATAAGG - Intergenic
926596653 2:14797284-14797306 TCCTGCATCCAAGAAGAATGAGG - Intergenic
926625508 2:15086407-15086429 TCCTGCGACCAGGAAGAATGAGG - Intergenic
926791912 2:16582107-16582129 TCCTGTGTCTTGATAGAGTGTGG + Intronic
926859202 2:17291277-17291299 TCTTGCATCCAGGAAGAATGAGG + Intergenic
926958776 2:18331855-18331877 TCCTGTGACCAGGAAGAATAAGG - Intronic
927072976 2:19548994-19549016 TCTGGTGTCCAGGAAGAATGAGG - Intergenic
927148340 2:20181122-20181144 TCAGGTGTCCTGAGAGAATGAGG - Intergenic
927226246 2:20768122-20768144 TTCTGCGACCAGGAAGAATGAGG - Intronic
927266829 2:21161657-21161679 TCCTGTGACCAGGAAGAATGAGG + Intergenic
927848726 2:26485713-26485735 GCCTGTGTCCTGCAAGCCTGTGG + Intronic
928182645 2:29080404-29080426 TCCCATGTCCAGGAAGAATGAGG + Intergenic
928242309 2:29597122-29597144 TCCTGTGGCCTTAAAGAATGCGG - Intronic
928441460 2:31295637-31295659 TCCAGCATCCTGGAAGAATCGGG - Intergenic
928470223 2:31568339-31568361 TCCCGTGTCCGGGAACAATGAGG + Intronic
928676205 2:33654315-33654337 TCCTGCATCCAAGAAGAATGAGG - Intergenic
928840539 2:35599600-35599622 TCCTGCATCTAGGAAGAATGAGG - Intergenic
929014629 2:37482052-37482074 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
929053862 2:37859364-37859386 TCCAGCATCCAGGAAGAATGAGG + Intergenic
929847071 2:45541471-45541493 TCCCATGTCCAAGAAGAATGAGG + Intronic
929968745 2:46555024-46555046 TCCTTGGCCCTGGAGGAATGGGG + Intronic
930512233 2:52359441-52359463 TCCTGTGTCCAAGAAGATGGAGG + Intergenic
930533220 2:52615554-52615576 TCCAGTGTCCAGGAGGAATGAGG - Intergenic
930566386 2:53025826-53025848 TCCTGTGATCTGCAACAATGTGG + Intergenic
930612081 2:53554684-53554706 TCCTGCGACCAGAAAGAATGAGG - Intronic
930630760 2:53752496-53752518 GCCTGTGCACTGGAAGAATGGGG - Intronic
930800615 2:55438891-55438913 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
930946589 2:57083904-57083926 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
930991040 2:57655095-57655117 TCCCATGTCCAAGAAGAATGAGG + Intergenic
931102245 2:59015323-59015345 TCCTGTGTCCAAGAAGAATGAGG + Intergenic
931300576 2:60974421-60974443 TCTTGCGTCCAGGAAGAATGAGG - Intronic
931414987 2:62072528-62072550 TCCCGTGTCCAAGAAGAATCAGG - Intronic
931733814 2:65176752-65176774 TCCTGCATCCAGGAAGAACGAGG + Intergenic
931795255 2:65702210-65702232 GCCTGTGTCCTGCAAGCATGAGG - Intergenic
931820174 2:65943651-65943673 TCCTGTGTCCAAGAAGGAGGAGG + Intergenic
932054661 2:68432213-68432235 TCCTATGTCCAGGAAGAATGAGG + Intergenic
932264447 2:70355085-70355107 CCCTCTGTCCTGTAAGACTGGGG + Intergenic
932485365 2:72081299-72081321 TCCCGCATCCAGGAAGAATGAGG - Intergenic
932501591 2:72187400-72187422 TCCTGCGACCAGGAAGAATGAGG + Intronic
932522502 2:72428149-72428171 TCCTGTGACCAGGAAGATTGAGG - Intronic
932644586 2:73487672-73487694 TCCTGCATCCATGAAGAATGAGG + Intronic
932727026 2:74188364-74188386 TCCTGCATCCAGGAAGAATGAGG - Intergenic
932873319 2:75425489-75425511 TCCTGCATCCAAGAAGAATGAGG + Intergenic
932960313 2:76406044-76406066 TCCAGTCTCCAGGAAGAATGAGG - Intergenic
933063683 2:77768779-77768801 TCCTGTGATCAGGAAGAATGAGG - Intergenic
933219219 2:79669452-79669474 TCCTGCATACAGGAAGAATGAGG + Intronic
933250616 2:80024871-80024893 TCTGGTGTCCAGGAAGAATTAGG + Intronic
933298210 2:80514514-80514536 TCTGGTGTCCAAGAAGAATGAGG + Intronic
933442736 2:82334161-82334183 TCCTATGTCCAGGAGAAATGAGG + Intergenic
933443740 2:82350020-82350042 TCCAGCATCCTGGAAGAATCAGG - Intergenic
933801089 2:85960987-85961009 TCCTGTGACCAGAAAGAATGAGG + Intergenic
934696462 2:96404119-96404141 TCCTGTGCCGAGGAAGAATGAGG + Intergenic
934699956 2:96431114-96431136 TCCTGTGACAAGGAAGAATGAGG - Intergenic
935897341 2:107751987-107752009 TCCAAAGTCCTAGAAGAATGAGG + Intergenic
936868651 2:117107571-117107593 TCCAGTGTCCAGGAAAAATAAGG - Intergenic
937003927 2:118493878-118493900 TCCTGTCTACAGGAACAATGAGG + Intergenic
937163974 2:119794812-119794834 TCCTGTGTCCAGGAAGAATGAGG + Intronic
937167880 2:119837531-119837553 TCCTCCCTCCAGGAAGAATGAGG - Intronic
937333446 2:121046024-121046046 AGCTGTGCCCTAGAAGAATGTGG - Intergenic
937837159 2:126483105-126483127 TCCTGCATCCAAGAAGAATGAGG + Intergenic
937966304 2:127514293-127514315 TCCTGCATCCAAGAAGAATGAGG - Intronic
938096385 2:128466917-128466939 TCCTGTGTCCAGGAAGAAGGAGG + Intergenic
938722045 2:134075894-134075916 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
938787757 2:134648050-134648072 TCCAGCGTCCAGGAGGAATGAGG + Intronic
939017579 2:136920170-136920192 TCCCATGTTCAGGAAGAATGAGG + Intronic
939084906 2:137707744-137707766 TCCTATGTCCAGGAAGAATGAGG + Intergenic
939384289 2:141475923-141475945 TCTGGTGTCCAGGAAGAATCAGG - Intronic
939460123 2:142488388-142488410 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
939463899 2:142532305-142532327 TACTGTGCCCAAGAAGAATGAGG - Intergenic
939466435 2:142562456-142562478 TCCTGCATCCAGGAAGAATGAGG - Intergenic
939539350 2:143474470-143474492 TCCTGGTTACTGGAAGAATTGGG + Intronic
939583992 2:143984920-143984942 TCCAGCGTCCAGGAAGAATCAGG - Intronic
939801912 2:146720998-146721020 TCCCATGTCAGGGAAGAATGAGG - Intergenic
939837729 2:147150720-147150742 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
939928378 2:148201632-148201654 TCCTGCATCCAAGAAGAATGAGG + Intronic
940694205 2:156958954-156958976 TCCCGTGTACAGGAAGAATGAGG + Intergenic
940711144 2:157164915-157164937 TCCTATGTCCAGGAAGATTGAGG + Intergenic
941043676 2:160649481-160649503 TCCTGCCTCCAGGAAGAATTAGG - Intergenic
941131120 2:161651376-161651398 TCCTGCATCCAGGAAGAATGAGG - Intronic
941852240 2:170195554-170195576 TCCAGTGTCCAGGAAGAATCAGG - Intronic
941858073 2:170250682-170250704 TCCAGTGTCCCGGAAGAACTGGG + Intronic
941929153 2:170923802-170923824 TCCCATATCCAGGAAGAATGAGG + Intergenic
941996395 2:171605603-171605625 TCTGGTGTCCAGGAAGAATCAGG + Intergenic
942053421 2:172162016-172162038 TCCTGTGTCCAGTAAGAATGAGG + Intergenic
942084949 2:172435138-172435160 TCCTTTGTCCTTGCAGAATCAGG + Intronic
942173358 2:173308472-173308494 TCCAGTGTCCAGGAAAAATCAGG - Intergenic
942297478 2:174531800-174531822 TCCTGTTTCCAGGAAGAAAAAGG + Intergenic
942377501 2:175352630-175352652 TGCTGGGTCCTGGTGGAATGAGG + Intergenic
942585706 2:177474500-177474522 GCCTGTGCACTGGAAGAGTGGGG - Intronic
942867995 2:180699256-180699278 TCCCATGTCCAGGGAGAATGAGG + Intergenic
943023419 2:182601553-182601575 TCCTGTGACCAGGAAGAATGAGG + Intergenic
943064157 2:183069546-183069568 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
943387423 2:187219431-187219453 TCCTAAGTCCTCAAAGAATGTGG + Intergenic
943426944 2:187749549-187749571 TCCTGTGCCTGGGAAGAATGAGG + Intergenic
943961269 2:194265699-194265721 TCCTGCATCCAGGAAGAATGAGG - Intergenic
944022638 2:195125281-195125303 TCCCATGTCCTGGAAAAATGAGG + Intergenic
944146805 2:196514850-196514872 TCCTGCATCCAGGAAGAATGAGG - Intronic
944483885 2:200182914-200182936 TCCTGCATCCAGGAAGAATGAGG - Intergenic
944530908 2:200667325-200667347 TCCTGTGTCATTGGAGAGTGTGG - Intronic
944586730 2:201179384-201179406 GCCTGCGTCCAGGAAGAATGAGG - Intergenic
944695772 2:202199167-202199189 TCCTGAGTCTTGGTAGAGTGAGG - Intergenic
944901742 2:204223021-204223043 TCCTGTGACTAGGAAGAATGAGG + Intergenic
945287658 2:208098374-208098396 TCCTGCGTCCAGAAAGAATGGGG + Intergenic
945561517 2:211346403-211346425 TCCTTTGTCGTGGAAGAACCAGG - Intergenic
945770351 2:214034930-214034952 ACCTGTGCCCAGGAAGAATGAGG + Intronic
945994629 2:216425617-216425639 TCCTGCGTCCAAGAAGAATGAGG + Intronic
946100451 2:217315906-217315928 TCCTGTGCCCAGGAAGAATCAGG - Intronic
946538414 2:220657470-220657492 TCCAGTGTCCTGGAAAGATTAGG + Intergenic
946609417 2:221441529-221441551 TCTGGTGTCCAGGAAGAATCAGG - Intronic
946652962 2:221913924-221913946 TCCTGTGCACTGGGAGGATGGGG - Intergenic
946712176 2:222517552-222517574 TCCAGTGTCCAGGAAGGATCAGG - Intronic
946789311 2:223284686-223284708 TCCTGTGTCCAGGAAGAACGAGG + Intergenic
946811553 2:223530868-223530890 TCCAGTGTCCAAGAAGAATGAGG - Intergenic
946907434 2:224430216-224430238 TCCAGTGTCCAAGAAGAATGAGG - Intergenic
947461418 2:230307289-230307311 TCCTGCAACCAGGAAGAATGAGG - Intronic
948293545 2:236844922-236844944 TCCTGCATCCAGGAAAAATGAGG + Intergenic
948432783 2:237930666-237930688 TCTCATGTCCAGGAAGAATGAGG - Intergenic
948434608 2:237944576-237944598 TCCCATGTCCAGGAAGAATGAGG - Intergenic
948575340 2:238946288-238946310 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
948713057 2:239837171-239837193 TCCTGCTTCCAGGAAGAATGAGG - Intergenic
1168983360 20:2026551-2026573 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1169918574 20:10708621-10708643 CGCTGTGTCTTGGAAGAATGTGG + Intergenic
1170043791 20:12065040-12065062 TCCTGCAACCAGGAAGAATGAGG + Intergenic
1170458427 20:16554549-16554571 TCCTGTGTCCAGAAAGAATAAGG - Intronic
1170495084 20:16916051-16916073 CCCTGCATCCAGGAAGAATGAGG - Intergenic
1170972939 20:21133584-21133606 TACTGTTTCCTGGAAGACAGAGG + Intronic
1171236856 20:23534526-23534548 TCCTGTTTCTGGAAAGAATGAGG + Intergenic
1171374761 20:24685098-24685120 TCCTGTTTCCTGGGGGGATGAGG + Intergenic
1171412395 20:24956215-24956237 TCCTGGGTCCTGGATGTCTGTGG - Intronic
1172347080 20:34210122-34210144 TCCTGCGTCCAGGAAGAATGAGG - Intronic
1172363624 20:34332402-34332424 TCCAGTGTTCAAGAAGAATGAGG - Intergenic
1172676756 20:36677810-36677832 TCCTGCATCCAGGAAGAGTGAGG - Intronic
1172991764 20:39041742-39041764 TCCTGAGTCTTGCAAAAATGAGG + Intergenic
1173207545 20:41006711-41006733 TCCCATGCCCGGGAAGAATGAGG + Intergenic
1173884495 20:46445553-46445575 TCCTATAACCAGGAAGAATGAGG + Intergenic
1173893885 20:46534873-46534895 TCTTGCATCCAGGAAGAATGAGG - Intergenic
1174075627 20:47933791-47933813 ACCTGTGTCCTCTGAGAATGTGG + Intergenic
1174411930 20:50341945-50341967 TCCTGTGTCCAGTAGGAATGTGG - Intergenic
1174997740 20:55589784-55589806 TCCAGTGTCTGGGAAGAATCAGG + Intergenic
1175001305 20:55633074-55633096 TCCTGCAACCAGGAAGAATGAGG + Intergenic
1175065157 20:56277872-56277894 TCCCGCATCCAGGAAGAATGAGG - Intergenic
1175312826 20:58023833-58023855 TCCTGTATCCAGGAAGAATGAGG + Intergenic
1175675876 20:60946189-60946211 TCCTGCGTTCAGGAAGAATGAGG - Intergenic
1175727927 20:61332173-61332195 GCCTGTCTCCTGGAGGAGTGAGG - Intronic
1175843015 20:62042396-62042418 TGCGGTGTCCAGGAAGAATCAGG - Intronic
1175959868 20:62630563-62630585 TCCTGCGACCAGGAAGAATGAGG + Intergenic
1176453163 21:6882326-6882348 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
1176599085 21:8775483-8775505 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1176628979 21:9119581-9119603 TCCTGAGTCCAGGAAAAATGAGG - Intergenic
1176645024 21:9341761-9341783 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1176831336 21:13747374-13747396 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
1176973211 21:15289766-15289788 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1176976568 21:15327658-15327680 TCCTGTAACCAGGAAGAATGAGG - Intergenic
1177037343 21:16060463-16060485 TCCTACATCCTGGAAGAATGAGG + Intergenic
1177125712 21:17191339-17191361 TCCCATGTCCAAGAAGAATGAGG - Intergenic
1177262654 21:18750411-18750433 TCCTGTGCCTAGGAAGAATGAGG - Intergenic
1177287026 21:19064940-19064962 TCCTGTGTCCAAAAAGAATGAGG - Intergenic
1177357769 21:20031304-20031326 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1177363664 21:20105169-20105191 TCCGGTGTCCAGGAAGAATCAGG - Intergenic
1177396029 21:20537675-20537697 TCCTGTATCCAGAAAGCATGAGG + Intergenic
1177546150 21:22561693-22561715 TCCTGCGTCTAAGAAGAATGAGG - Intergenic
1177703854 21:24674611-24674633 CCCTGTGTCCAGGAGGAATGAGG - Intergenic
1177875338 21:26625562-26625584 TCCCATGTCCAGGAAGAATGAGG + Intergenic
1177962080 21:27679867-27679889 TCCAGAGTCCAAGAAGAATGAGG + Intergenic
1178087035 21:29122423-29122445 TTCAGTGTCCAGGAAGAATCAGG + Intronic
1178113941 21:29398062-29398084 TCCTGTTTTCTGGATGAATGAGG - Intronic
1178447377 21:32658493-32658515 TCTGGTGTCCAGGAGGAATGAGG - Intronic
1178937475 21:36875719-36875741 TCCTGCATCCAGGAAGAAGGAGG - Intronic
1178947427 21:36959802-36959824 TCCTGCATCCAGGAAGAATGAGG - Intronic
1179354727 21:40648880-40648902 TCCCGTGTCCAAGAAGAATGAGG - Intronic
1179400081 21:41075732-41075754 TCCTGCGTCCAAGAAGAATGAGG - Intergenic
1179407415 21:41137157-41137179 TCCAGTGTGCAGAAAGAATGAGG - Intergenic
1179411067 21:41163585-41163607 TTCTGTGTCCTGCCAGGATGCGG + Intergenic
1179526237 21:41977709-41977731 CCCGCTATCCTGGAAGAATGCGG - Intergenic
1179956189 21:44740437-44740459 CCCTGTGCACTGGGAGAATGGGG + Intergenic
1180025912 21:45161987-45162009 TCCCATGTCCAGGAAGAATGAGG - Intronic
1180153144 21:45962736-45962758 GCCTGTGCACTGGGAGAATGGGG - Intergenic
1180178856 21:46108876-46108898 TCCTGTGTCCAGGAAGAATGAGG + Intronic
1180251701 21:46594473-46594495 TCCCGCGTCCAAGAAGAATGAGG - Intergenic
1180326545 22:11435093-11435115 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1180367927 22:11957473-11957495 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
1180378161 22:12113863-12113885 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1180419345 22:12799418-12799440 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
1180580637 22:16832812-16832834 TCCTGCATGCAGGAAGAATGAGG + Intergenic
1181316413 22:21973544-21973566 TCTTGCATCCTGGGAGAATGGGG + Intronic
1181450086 22:23014012-23014034 TCCAATGTCCAGGAAGAATCAGG + Intergenic
1181689097 22:24548594-24548616 TTCTGGCTCCTGGGAGAATGGGG - Intronic
1181875253 22:25935608-25935630 CCCTGTGTCTTAGAAAAATGGGG + Intronic
1182710237 22:32318063-32318085 TGCAGTGTCCTGGAAGCAGGTGG - Intergenic
1184173933 22:42775383-42775405 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1184195650 22:42925930-42925952 GTCAGTCTCCTGGAAGAATGGGG + Intronic
1184613653 22:45622840-45622862 TCCTGCATCCAGAAAGAATGAGG - Intergenic
1184665751 22:45988117-45988139 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1184865776 22:47201215-47201237 TCCTGCGACCAGGAAGAATGGGG + Intergenic
1185215390 22:49596891-49596913 TCCTGCTTCCTGGAGGAATTTGG - Intronic
1185367490 22:50443572-50443594 TCTGGGGTCCTTGAAGAATGAGG + Intronic
949307793 3:2662583-2662605 TTCTGGGTCCTGCAAGGATGGGG + Intronic
949464780 3:4333120-4333142 TCCAGTGTCCTGGAAGAATCAGG - Intronic
949473188 3:4418092-4418114 CCATGTGTCCTGGAATGATGCGG - Exonic
949996233 3:9619534-9619556 TCCTGCATCCAAGAAGAATGAGG - Intergenic
950207663 3:11092998-11093020 TCTTGTGTCCAAGAAGAATGAGG - Intergenic
950689419 3:14643785-14643807 TCCTGGGTCCTGCAAGAGAGAGG - Intergenic
950932199 3:16801445-16801467 TCCTGTGCCCAGGAAGAACTGGG - Intergenic
950994539 3:17480874-17480896 TCCTGCATCCAGGAAGAATGAGG - Intronic
951136155 3:19106758-19106780 TCCTGTGACCAGGAAGAATGAGG + Intergenic
951250972 3:20394210-20394232 TCCAGTGCCCAAGAAGAATGAGG - Intergenic
951264658 3:20552088-20552110 TCCTAAGTCCAGGAAGAATGAGG + Intergenic
951562366 3:23981687-23981709 TCCTGCAACCAGGAAGAATGAGG + Intergenic
951566806 3:24019598-24019620 TTTTGTGCCCAGGAAGAATGAGG + Intergenic
951637801 3:24798742-24798764 TCCAGTGTCCTGGAAAAATTGGG - Intergenic
951651811 3:24959249-24959271 TTCTGTGTCCAGGAAAAATCAGG + Intergenic
951798162 3:26565889-26565911 TCCTGCATCCAGAAAGAATGAGG + Intergenic
951822147 3:26825513-26825535 TCCTGCATCCAAGAAGAATGGGG - Intergenic
952181466 3:30920816-30920838 TCTGGTGTCCAGGAAAAATGAGG - Intergenic
952269306 3:31816678-31816700 ACCTGCATCCAGGAAGAATGAGG + Intronic
952408603 3:33026936-33026958 TCCTACATCCAGGAAGAATGAGG - Intronic
952494836 3:33906795-33906817 TGCTGTGTGGTGGAAGAATTGGG + Intergenic
952657308 3:35801737-35801759 TCCCATGTCAGGGAAGAATGAGG + Intergenic
952793394 3:37218002-37218024 TCCTGTGTCCAGAAAGAATGAGG - Intergenic
953147409 3:40291226-40291248 TCCTGTGTCCAAGAGGAATGAGG + Intergenic
953289902 3:41650215-41650237 TGCTGCATCCAGGAAGAATGAGG - Intronic
953521820 3:43650103-43650125 TCCAGTGTCCCAGAAGAATCAGG + Intronic
953567079 3:44042027-44042049 TGGTGTCTCCTGGAAGAATGAGG + Intergenic
953878806 3:46681166-46681188 GCCTGTGTCCTGCAACAATCTGG + Intronic
954248409 3:49349729-49349751 TCCTGTTTCCTGGGATCATGGGG + Intergenic
954386048 3:50244614-50244636 TACTGTGTGGTGGTAGAATGTGG + Intronic
954460546 3:50624386-50624408 ACCTGTGTTCTGGCAGGATGTGG + Intronic
954563505 3:51578886-51578908 TTCGGTATCCAGGAAGAATGAGG + Intronic
955102909 3:55869537-55869559 ACCTGTGTGGTGGAAGAATTTGG - Intronic
955241446 3:57182229-57182251 TCCTGCATCCAGGAAGAATGAGG + Intergenic
955303852 3:57809888-57809910 TGCTGTGTCCAGGAAGAAAAGGG - Intronic
956039422 3:65130743-65130765 TCATATGTCAAGGAAGAATGAGG - Intergenic
956216412 3:66853913-66853935 TCCTGTGTGCTGGTAGCATAAGG - Intergenic
956462247 3:69484445-69484467 TCCTGTGTCCAGGAAGACTGAGG + Intronic
956541458 3:70344512-70344534 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
956803573 3:72786361-72786383 GCCTTTGTCCTGGGAGAATATGG - Intronic
956888415 3:73584318-73584340 TCCTGTTTCCTGGATGGAAGTGG - Intronic
957095307 3:75772283-75772305 TCCTGCATCCAGGAAGAATGAGG - Intronic
957287767 3:78239131-78239153 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
957307816 3:78480868-78480890 TCCTGCCTCCAGGAAGAATGAGG - Intergenic
957427084 3:80052143-80052165 CCCTATGTCCAGGAAGAATGAGG - Intergenic
957486746 3:80871398-80871420 TTCTGTGCCTAGGAAGAATGAGG - Intergenic
957614093 3:82506050-82506072 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
957614555 3:82509949-82509971 TACTGAGTCCGGGAAGAATGAGG - Intergenic
957618641 3:82566859-82566881 CTCACTGTCCTGGAAGAATGAGG - Intergenic
957624469 3:82641231-82641253 TTTTGTATCCAGGAAGAATGAGG - Intergenic
957705206 3:83770904-83770926 TCCTGTTTCCAGGAAGAATGAGG - Intergenic
957775813 3:84756484-84756506 TCCTGCATTCAGGAAGAATGAGG + Intergenic
957824476 3:85422980-85423002 TCCTGCGTCCAGGAAGAATCAGG + Intronic
957991860 3:87636377-87636399 ACGTGTGCACTGGAAGAATGGGG + Intergenic
958418804 3:93907641-93907663 TCCTGCATCCATGAAGAATGAGG - Intronic
958498343 3:94874420-94874442 TCCTGTGTCCAAGAAGAATTAGG + Intergenic
958536186 3:95407784-95407806 ACCTGTGCACTGGAAGAATGGGG + Intergenic
958636316 3:96751024-96751046 TCCTGCATCCAGGAAGAATGAGG - Intergenic
958675503 3:97264679-97264701 TCCTGTAACTAGGAAGAATGAGG + Intronic
959037526 3:101384232-101384254 TCCTGTGTTCAGGAAGAATTAGG - Intronic
959062079 3:101625079-101625101 TCCTGTGCCCAAGAAGAATGAGG + Intergenic
959065192 3:101648885-101648907 TCCAGCGTCCAGGAAGAATCAGG + Exonic
959389682 3:105759036-105759058 TCCCGTGTCCAGGAAGAATGAGG + Intronic
959412648 3:106044693-106044715 TACTGTGTGCTGAATGAATGAGG + Intergenic
959484332 3:106909346-106909368 TTCTATGTCCAGAAAGAATGAGG - Intergenic
959484641 3:106913130-106913152 TCCCGCATCCAGGAAGAATGAGG - Intergenic
959774005 3:110134923-110134945 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
959857335 3:111174912-111174934 TCCAGTGTCCCGGTAGAATTGGG + Intronic
960011077 3:112835132-112835154 TCCTGTGACCAGGAAGAATGAGG + Intronic
960395419 3:117131258-117131280 TCTGGTGTCCAGGAAGAATCAGG - Intronic
960634186 3:119767735-119767757 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
960690661 3:120342703-120342725 TCCTGCATCCAGGAAGAATGAGG - Intronic
960714291 3:120560077-120560099 GCCTGTGTCCTGCCAGAATGGGG - Intergenic
961311449 3:126004463-126004485 TCCTGCCTCCAGGAGGAATGAGG - Intergenic
961459959 3:127043932-127043954 GCCTGTGGCCAGGAGGAATGAGG - Intergenic
961493669 3:127275086-127275108 CCCTGCATCCAGGAAGAATGAGG - Intergenic
961525859 3:127496944-127496966 TCCTGCATCCAGGAACAATGAGG - Intergenic
961587688 3:127947421-127947443 TCCTCTATCCTGGAAGACTGTGG + Intronic
961942915 3:130656263-130656285 TCCTGCATCCTGGAAGAATGAGG + Intronic
962105106 3:132381914-132381936 TCCTGAGACCAGGAAGAATGAGG + Intergenic
962211952 3:133486820-133486842 TCCCACGTCCAGGAAGAATGAGG + Intergenic
962253575 3:133854887-133854909 TACTGTGTCTTGTCAGAATGTGG - Intronic
962763793 3:138542788-138542810 TCCTGTGTCCAGGAAGAATGAGG + Intronic
962824474 3:139088045-139088067 TCTTGTGCCCAGGAAGAATGAGG + Intronic
963328641 3:143890015-143890037 TCCTATGAGCTGGAAGAGTGAGG + Intergenic
963346326 3:144099682-144099704 TCCCATGCCCAGGAAGAATGAGG - Intergenic
963454201 3:145522728-145522750 TCCTGCAACCAGGAAGAATGAGG + Intergenic
963534868 3:146514682-146514704 TCCGGTGTCCAGGAAAAATGTGG - Intergenic
963721656 3:148868368-148868390 TCCTCTCTCCTGAAATAATGGGG - Intronic
964075124 3:152684116-152684138 CCCTGTGTCCAGGAGGAATGAGG + Intergenic
964247157 3:154666940-154666962 TCCAGTGTCCAGGAAAAATCAGG + Intergenic
964341683 3:155714915-155714937 TTCTATTTCCTGGAAGAATTAGG + Intronic
964731513 3:159871848-159871870 ACCTGTGGCCTGGCAGAATCAGG - Intronic
964927241 3:161974663-161974685 TCTTGTGTTCAGGAAGAATGAGG + Intergenic
964972247 3:162577097-162577119 ACCTGTGTTCTAGAAGAATATGG + Intergenic
964987820 3:162766233-162766255 TCCTGTGTCCAAGAAGAATGAGG + Intergenic
964996840 3:162892191-162892213 TCCTGCACCCCGGAAGAATGAGG - Intergenic
965005695 3:163019594-163019616 TCCTGCATCTAGGAAGAATGAGG - Intergenic
965013973 3:163131966-163131988 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
965039690 3:163490494-163490516 CCCTGTGTCCAAGAAGAATGAGG + Intergenic
965115088 3:164478122-164478144 TCCTGCATCCAGGAAGAATGAGG - Intergenic
965205157 3:165712857-165712879 TCCTGCATCCAGGAAGAATGAGG + Intergenic
965206105 3:165720421-165720443 TCCCGTGTCCAGGAAGAATGAGG + Intergenic
965229134 3:166028662-166028684 TCCTGCATCCAGGAAGAATGAGG + Intergenic
965272781 3:166639219-166639241 TACTGCCTCCAGGAAGAATGAGG - Intergenic
965282484 3:166771324-166771346 TCCAGCATCCTGGAAGAATCGGG - Intergenic
965309841 3:167115200-167115222 TCCTGCGACCAGGAAGAATGAGG + Intergenic
965541486 3:169875717-169875739 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
965542117 3:169880683-169880705 TCCTGCATCCAGGAAGAATGAGG - Intergenic
965813334 3:172613837-172613859 TCCTGCAACCAGGAAGAATGAGG + Intergenic
965984599 3:174736317-174736339 TCCTGTGTCCAGGTAGAATGAGG + Intronic
966256194 3:177918500-177918522 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
966491549 3:180532605-180532627 TGCATTGTCCAGGAAGAATGAGG - Intergenic
966520688 3:180870304-180870326 TCCGGCGTCCAGGAAGAATTAGG + Intronic
966840202 3:184081891-184081913 TCCTGTGTCCTGGAAGAATGAGG - Intergenic
967422245 3:189286510-189286532 CCCTATGTCCTGGAAGTAGGAGG - Intronic
967444762 3:189554333-189554355 TCCTGCATCCAGGAAGAATGTGG + Intergenic
967649821 3:191973100-191973122 TCCTGTGACCAGGAACAATGAGG + Intergenic
968142897 3:196273414-196273436 TCCCACGTCCAGGAAGAATGAGG + Intronic
1202741867 3_GL000221v1_random:63307-63329 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
968393401 4:211645-211667 TCCCATGACCTGGAAAAATGAGG - Intergenic
968538583 4:1150630-1150652 TCCTGTGACCAGGAAGAATGAGG + Intergenic
968838279 4:2981321-2981343 TCCCATGTCCAGGAAGAATGAGG + Intronic
969179285 4:5424703-5424725 TCCTGTGTCCAGGAAGAATGAGG - Intronic
970612975 4:17742805-17742827 TCTGGTGTCCAGGAAGAATCAGG - Intronic
970935938 4:21569941-21569963 TGCTGTGTGTTGGGAGAATGGGG + Intronic
970943338 4:21661272-21661294 TCCAGTGTCCAGGAAGAATCAGG - Intronic
971427316 4:26529418-26529440 TCCTGCATCCAGGAAGAATCAGG + Intergenic
971572408 4:28230194-28230216 TCCTGGGCACTGGGAGAATGAGG + Intergenic
971669768 4:29542295-29542317 TCTCATGTCCAGGAAGAATGAGG + Intergenic
971714031 4:30152974-30152996 TCCTGCGTCCAGGAAGCACGAGG + Intergenic
971741920 4:30532481-30532503 TACAGTGTCCTGGTAGAATAAGG + Intergenic
971876788 4:32318541-32318563 TCTCATGTCCAGGAAGAATGAGG + Intergenic
971938734 4:33188227-33188249 TCCTCTGCCCAGGAAGAATAAGG + Intergenic
972072622 4:35039359-35039381 TCCTGCGTCCAGCAGGAATGAGG - Intergenic
972106523 4:35494838-35494860 TCCCATTTCCAGGAAGAATGAGG - Intergenic
972158769 4:36198056-36198078 TGCTGTGTCCAGAAAGAAGGAGG + Intronic
972203985 4:36748468-36748490 TCCTGCGTCCAGGGAGAATGAGG - Intergenic
972645887 4:40967260-40967282 TCCTACGTCCAGGAAGAATGAGG - Intronic
972852759 4:43071087-43071109 TCCAGTGTCCCAGAAGAATCGGG - Intergenic
972867922 4:43257138-43257160 TCTTGTGACCAAGAAGAATGAGG + Intergenic
972930973 4:44071352-44071374 TCCTGTGACCAGGAAGAATGAGG + Intergenic
973026849 4:45283904-45283926 TTCTATGTCCAGGAAGAATGAGG + Intergenic
973362441 4:49177855-49177877 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
973398659 4:49619006-49619028 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
973534474 4:51867429-51867451 TCCCGCATCCAGGAAGAATGAGG + Intronic
973661658 4:53113386-53113408 GCCTGTGTCCTGGAGTAAGGGGG + Intronic
973968123 4:56184381-56184403 TTCTTTGTCCTGGAAGTGTGTGG + Intronic
974174963 4:58309908-58309930 TCTGGTGTCCAGGAAGAATGAGG + Intergenic
974260223 4:59517554-59517576 TCCTGTGACCAGGAAGAATGAGG + Intergenic
974278432 4:59758819-59758841 TCCTATGTTCAGGAAGAATGAGG + Intergenic
974420199 4:61663079-61663101 TCCCATGTTCAGGAAGAATGAGG - Intronic
974651553 4:64759740-64759762 TCCTGCATCCAGGAAGAATGAGG - Intergenic
974673278 4:65058436-65058458 TCTGGTGTCCAAGAAGAATGAGG - Intergenic
974674103 4:65068999-65069021 TCCCGTATCCAGGAAAAATGAGG - Intergenic
974894919 4:67927124-67927146 TCCTGAGACCAAGAAGAATGAGG - Intronic
975008544 4:69321186-69321208 TCTTGTGACCAGGAAGAATGAGG - Intronic
975023607 4:69521173-69521195 TCCCATGTCCAGGAAGAATTAGG - Intronic
975044458 4:69784079-69784101 TCCTGTAACCAGGAAGAATGAGG - Intronic
975253764 4:72211622-72211644 TCCTGCATCCAGGAAGAATGAGG + Intergenic
975254293 4:72215777-72215799 TCCTGTGTCCAGGAAAAATGAGG + Intergenic
975299779 4:72775705-72775727 TCCTGTGTCTAGGAAGAATTAGG - Intergenic
975498369 4:75058292-75058314 TCCTGCGTCCAGGAAGAAAGAGG - Intergenic
975597725 4:76066268-76066290 TCCTGCGTCCAGGAAGAATGAGG + Intronic
975707769 4:77128029-77128051 TTCGGTGTCCAGGAAGAATCAGG + Intergenic
975756705 4:77578511-77578533 ACCTGTGCACTGGGAGAATGGGG + Intronic
975830386 4:78362667-78362689 TCCGGTGTCTGAGAAGAATGGGG + Intronic
975910330 4:79259125-79259147 TCCTGCATACAGGAAGAATGAGG - Intronic
976097770 4:81527733-81527755 TTCTGTGTCCAGGAAGAATGAGG + Intronic
976626757 4:87192633-87192655 TCATGTGTCATTGAAGGATGGGG + Intronic
976647403 4:87400282-87400304 TCCCATGTCCAGGAAGAAGGGGG - Intergenic
976675408 4:87697383-87697405 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
976700847 4:87967033-87967055 TCCTGTGACCAGGAAGAATGAGG - Intergenic
976815792 4:89147895-89147917 TCCTGTGTCCAGGAAGAATAAGG + Intergenic
976921401 4:90448909-90448931 TCCTGCATCCAGGAAGAATGAGG + Intronic
976922620 4:90457426-90457448 TCTTGTTTCCAGGAAGAATGAGG + Intronic
977019364 4:91740761-91740783 TCCGGTGTCCAGGAGAAATGAGG - Intergenic
977254701 4:94727753-94727775 TCTGGTGTCCAGGAAGAATGAGG - Intergenic
977471925 4:97452956-97452978 CCCTGTGACCAGGAAGAATGAGG - Intronic
977645874 4:99410705-99410727 TCCTGCGAACTGGAAGAATGAGG + Intergenic
977672909 4:99716428-99716450 TCCAGTATCCAGGAGGAATGAGG - Intergenic
977816190 4:101416524-101416546 TCCTGCGTCCAGGAATAATGAGG + Intronic
978229844 4:106385428-106385450 TCCTGTGACCAGGAAGAATGAGG + Intergenic
978248512 4:106603961-106603983 TCCTATGTCCAGGAAGAATGAGG + Intergenic
978249326 4:106611056-106611078 TCCTGCATCCAGAAAGAATGAGG - Intergenic
978301003 4:107269763-107269785 TCCTGTATCCAAGAAGAATGAGG + Intronic
978347596 4:107788248-107788270 TCCCATGTCCAGGAAGAATGAGG + Intergenic
978579783 4:110220333-110220355 TCCGGTGTCCAGGAAGAATCAGG + Intergenic
978663368 4:111154220-111154242 TCCTGTGTCCTGGAAGAATGAGG + Intergenic
978964485 4:114725046-114725068 GCCTGCATCCAGGAAGAATGAGG + Intergenic
979010839 4:115366208-115366230 TCCCGTGTCCAGGAAGAGTGAGG - Intergenic
979297979 4:119054405-119054427 TCCGGCGTCCAGGAAGAATGAGG + Intronic
979448159 4:120839273-120839295 TCCTGTGACCAGGAAAAATGAGG + Intronic
979462919 4:121003856-121003878 TCCTATGACCAGGAAGAATGAGG - Intergenic
979649437 4:123113759-123113781 TCCTGCATCTAGGAAGAATGAGG + Intronic
980180300 4:129393163-129393185 TCCTGTGACCAGGAAGAATGAGG - Intergenic
980243246 4:130203403-130203425 TCCTATAACCAGGAAGAATGAGG - Intergenic
980253573 4:130349047-130349069 TCCCGTGTCCAGGGAGAATGAGG + Intergenic
980299717 4:130972997-130973019 TCTGGTGTCCAAGAAGAATGAGG - Intergenic
980308682 4:131099567-131099589 TCCCATGTCGGGGAAGAATGAGG + Intergenic
980450278 4:132960198-132960220 TCCTGTGTCTAGGAAGAATGGGG - Intergenic
980554629 4:134387144-134387166 TCCAGAGTCCAGGAAGAATCAGG - Intergenic
980574321 4:134665955-134665977 TCCCCTATCCAGGAAGAATGAGG + Intergenic
980671193 4:136008990-136009012 TCCTGTGTCAAGGAAGAATGAGG - Intergenic
980703188 4:136458150-136458172 TCCTGCACCCAGGAAGAATGAGG - Intergenic
980729761 4:136811190-136811212 TCCTGTGACCAGGAAGAATGAGG + Intergenic
980745010 4:137001441-137001463 TCTTGCATCCAGGAAGAATGAGG - Intergenic
980750015 4:137076636-137076658 TCCTGCATCCAGGAAGAATGAGG + Intergenic
980970422 4:139562114-139562136 TACAGTGTTCTGAAAGAATGAGG + Intronic
981106397 4:140886284-140886306 TCCTCTATTCTGGAAAAATGTGG - Intronic
981235491 4:142410452-142410474 TGCTTTGTTCTGGAAGAAAGAGG - Intronic
981340609 4:143617447-143617469 TCCTCTGCCCTGGAAGACAGAGG + Intronic
981362792 4:143866644-143866666 TCCGGTGTCCAGGAAGAATCAGG - Intergenic
981373521 4:143987444-143987466 TCCGGTGTCCAGGAAGAATCAGG - Intergenic
981382623 4:144090715-144090737 TCCGGTGTCCAGGAAGAATCAGG - Intergenic
981889150 4:149715654-149715676 TCCCATGTCCAGGAAGAATGAGG + Intergenic
982157985 4:152540095-152540117 TCCCGTGACCAGGAAGAATGAGG + Intergenic
982526636 4:156487317-156487339 GCCTGTGCACTGGGAGAATGGGG + Intergenic
982611108 4:157575167-157575189 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
982802541 4:159722626-159722648 TCCTGCATCCGGGAAGAAGGAGG + Intergenic
982856166 4:160385308-160385330 TCCCATGTCCAGGAAGAATGAGG + Intergenic
983000521 4:162408837-162408859 TCTTGCGTCCAGGAAGAATGAGG + Intergenic
983347610 4:166546590-166546612 TCCTGCATCCAAGAAGAATGAGG + Intergenic
983431050 4:167652058-167652080 TCCTGTGACCAGGAAGAATGAGG - Intergenic
983448926 4:167887459-167887481 TCCTGTGTCCAAGAAGAATGAGG - Intergenic
983462639 4:168047026-168047048 TCTGGTGTCCTGGAAAAATGAGG + Intergenic
983491976 4:168399116-168399138 TCCCGTATCCAGGAAGAATGAGG - Intronic
983715506 4:170776789-170776811 CCCTGTGTCCAGGAAGAATGAGG - Intergenic
983781447 4:171674763-171674785 TCCAGCATCCTGGAAGAATTGGG - Intergenic
983885361 4:172975137-172975159 TCCTGCATCCAGGAAGAATGAGG + Intronic
984102068 4:175499035-175499057 TCCTGCAACCAGGAAGAATGAGG + Intergenic
984169386 4:176342970-176342992 TCCCATGTCCAGAAAGAATGAGG + Intergenic
984245331 4:177268577-177268599 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
984325265 4:178242529-178242551 TCCTGTGTCCAGGCAGAATGAGG - Intergenic
984337900 4:178415768-178415790 TCCCATGTCCAGGAAGGATGAGG - Intergenic
984400398 4:179257080-179257102 TCCTGCATCCAAGAAGAATGAGG + Intergenic
984417237 4:179477296-179477318 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
984512772 4:180698976-180698998 GCCTGTGCACTGGGAGAATGGGG + Intergenic
984520517 4:180796284-180796306 TCCAGTGTCCTGGAATGATAGGG + Intergenic
984763867 4:183384768-183384790 TCCCACGTCCAGGAAGAATGAGG - Intergenic
1202759778 4_GL000008v2_random:99328-99350 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
985497284 5:216537-216559 TCCTGTGAACAGGAAGACTGAGG + Intronic
985738296 5:1598419-1598441 TCCTGTGAACAGGAAGACTGAGG - Intergenic
985752917 5:1692626-1692648 TCTGGTGTCCAGGAGGAATGAGG + Intergenic
986215029 5:5712239-5712261 TCCTGCATCCAGGAAGAATGAGG + Intergenic
986371821 5:7087835-7087857 TCCAGTATCCAAGAAGAATGAGG - Intergenic
986457266 5:7931862-7931884 TCCAGCATCCTGGAAGAATTGGG - Intergenic
986588718 5:9346379-9346401 TCTGGTGTCCAGGAAAAATGAGG - Intronic
987190209 5:15469851-15469873 TCCAATGTCCAGGAAGAATCAGG + Intergenic
987815950 5:22901383-22901405 TCCTACGTCCAGGAAGAATGAGG + Intergenic
987875461 5:23675218-23675240 TCACATGTCCAGGAAGAATGAGG - Intergenic
987926579 5:24350120-24350142 CCCGGTGTCCAGGAAGAATCAGG + Intergenic
988018389 5:25591170-25591192 CCCTGCTTCCTGGAAGAATGAGG + Intergenic
988202304 5:28083641-28083663 TCCTGCATCCAGGAAGAATGAGG - Intergenic
988231349 5:28483744-28483766 TTCAGTGTCCAGGAAGAATCAGG + Intergenic
988565857 5:32319758-32319780 TCCTGCATCCGGGAAGAATGAGG + Intergenic
988641027 5:33041029-33041051 TCCCATGTTCAGGAAGAATGAGG + Intergenic
988681597 5:33489221-33489243 TCCTGCATCCAAGAAGAATGAGG + Intergenic
988776541 5:34482396-34482418 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
988782717 5:34538056-34538078 TACTGTGCCCAAGAAGAATGAGG + Intergenic
988940447 5:36139891-36139913 TCCTACATCCAGGAAGAATGAGG - Intronic
989161269 5:38393882-38393904 TCCGGTGTCCAGGAAGAATCAGG + Intronic
989189204 5:38653697-38653719 TCCTGTCACCTGGAACAAGGGGG - Intergenic
989279117 5:39621433-39621455 TCCTGTGACCAGGAAGAATGAGG + Intergenic
989448143 5:41554969-41554991 CCCTATTTCCTGGAAGAATGAGG - Intergenic
989520728 5:42397022-42397044 TCCTGTGTCCAGGGAGAATGAGG - Intergenic
989585465 5:43071146-43071168 TCCTGCATCCAAGAAGAATGAGG - Intronic
989719141 5:44504106-44504128 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
989821745 5:45801013-45801035 TTCTGTGTCCAGGAAGAATGAGG - Intergenic
990371906 5:55128462-55128484 TTCTGTGTCCTGGATAAAAGAGG - Exonic
990444903 5:55885541-55885563 GCCTGTGCACTGGGAGAATGGGG - Intronic
990639192 5:57762453-57762475 TCCTGTGCCCAGGAAGAATGAGG - Intergenic
990878824 5:60517789-60517811 TCCTGTGTCCTGGAAGAATGAGG - Intronic
990923412 5:60993453-60993475 TCCTGAGTCCAGGAAGAATGAGG + Intronic
991207467 5:64065985-64066007 TCTAGTGTCCAGGAAGAATCAGG - Intergenic
991359219 5:65802625-65802647 TCCCGTGCCCAGGAAGAAGGAGG + Intronic
991644975 5:68792568-68792590 TCCGGTGTCCAGAAAGAATCAGG + Intergenic
991653807 5:68883138-68883160 TCCAGTGTCCTGGGACAGTGAGG + Intergenic
992226067 5:74620690-74620712 TCTGGTGTCCAGGAAGAATCCGG + Intergenic
993187011 5:84634814-84634836 TCCTGAGACCAGGAAGAATGAGG + Intergenic
993211805 5:84961755-84961777 TCCTGCATCCATGAAGAATGAGG + Intergenic
993384730 5:87251208-87251230 TCCTGCATCCAGGAAGAATGAGG + Intergenic
993617971 5:90136501-90136523 TCCTGCATCCAGGAAGAATGAGG + Intergenic
993835736 5:92818060-92818082 TCCTGTGACCAAGAGGAATGAGG - Intergenic
993937957 5:94026360-94026382 TCCTGTGTCCAAGAAGAAGGAGG + Intronic
994245335 5:97470744-97470766 TCCTGTGACCAGGAAGAATGAGG + Intergenic
994596155 5:101838473-101838495 TACTTAGTGCTGGAAGAATGTGG - Intergenic
994641007 5:102410061-102410083 TCCTGTGTCCAGGAAGAATGAGG + Intronic
994753165 5:103763924-103763946 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
994762803 5:103878128-103878150 TCCAGCGTCCAGGAAGAATCAGG + Intergenic
994851309 5:105057787-105057809 TACTGTGACCAGGAAGAAAGAGG - Intergenic
994898841 5:105744424-105744446 TCTGGTGTCCAGGAGGAATGAGG - Intergenic
994948127 5:106423048-106423070 TCCCATGTCCAGGAAGAATGAGG - Intergenic
994999075 5:107104414-107104436 TTCAGTGTCCAGGAAGAATCAGG - Intergenic
995159881 5:108967201-108967223 TCCTGCGTCCAAGAAGAATAAGG + Intronic
995319987 5:110823637-110823659 TCCTGCATCCAAGAAGAATGAGG - Intergenic
995386678 5:111596498-111596520 TCTTCCGTCCTGGAAGAATGAGG - Intergenic
995744484 5:115389772-115389794 TGCTGTGTCATGGAAGATAGAGG - Intergenic
995744908 5:115393279-115393301 TCCTGCATCCAGGAAGAATGAGG + Intergenic
995863038 5:116661595-116661617 TCCCATGTCCAGGAAGAATGAGG - Intergenic
996217511 5:120887370-120887392 TCCTGTATCCAGAAAGAATGAGG + Intergenic
996250151 5:121319210-121319232 TCCAGTGGCCAAGAAGAATGAGG - Intergenic
996923783 5:128799647-128799669 TCCTGCATCCAGGAAGAATGAGG + Intronic
997102246 5:130981805-130981827 TCCTGCATCCAAGAAGAATGAGG - Intergenic
997318132 5:132954958-132954980 TCCGGTATCCAGGAAGAATCAGG + Intronic
997359432 5:133285335-133285357 ACCAGTGTCCTGGCAGAATGAGG + Intronic
997509799 5:134446393-134446415 TCCACTGTCCAGGCAGAATGTGG - Intergenic
997926240 5:138033189-138033211 CCCTGTGTCCTGCAAGCTTGAGG + Intronic
998641172 5:144013033-144013055 ACCTGTGTCCTGGGAGAACAGGG - Intergenic
998791182 5:145767416-145767438 TCCTGCATCCAGGAAGAATCAGG - Intronic
998991307 5:147821006-147821028 CCCTGTGTCCTGGGAGAAGTTGG - Intergenic
999315363 5:150580005-150580027 TCCTGTGTCCAGGAAGTATGAGG - Intergenic
999799345 5:155019070-155019092 TCCAGCGTCCAGGAAGAATGAGG + Intergenic
999810945 5:155126703-155126725 TCCAGTGTCCTGGAAAAATTGGG + Intergenic
999811435 5:155131253-155131275 TCCAGTGTCTTGGAAGAATCAGG + Intergenic
1000234429 5:159344466-159344488 TCCTATGTCCAGGAAGAATCAGG + Intergenic
1000426272 5:161094225-161094247 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1000684370 5:164228813-164228835 TCCAGTGCCCAAGAAGAATGAGG - Intergenic
1000949402 5:167462458-167462480 TCCAGCGTCCAGGAAGAATCAGG + Intronic
1001973746 5:175979422-175979444 TCCAGCGTCCAAGAAGAATGAGG - Intronic
1002243686 5:177864357-177864379 TCCAGCGTCCAAGAAGAATGAGG + Intergenic
1002677978 5:180934906-180934928 TCCCATATCCAGGAAGAATGTGG + Intronic
1002689115 5:181038034-181038056 TCCTGCCTCCAGGAAGAATGAGG - Intergenic
1002762671 6:214138-214160 TCCCATGTCCAGGAAGAATCAGG - Intergenic
1002921651 6:1577309-1577331 GCCAGTGTCCTGGGAGAAGGAGG - Intergenic
1002986287 6:2192371-2192393 TCTTGTGACCAGGAAGACTGAGG - Intronic
1003439047 6:6122574-6122596 CCCTGTGTCCAGGAAGAATGAGG - Intergenic
1003687842 6:8322552-8322574 TCCAATGTCCAGGAAGAATCAGG + Intergenic
1003791657 6:9553175-9553197 TCCCATGTCCCAGAAGAATGAGG + Intergenic
1003963272 6:11229133-11229155 TCCTGTGTTCTGGTTGAATGGGG - Intronic
1004182957 6:13396691-13396713 AGCTGTGTCCTGGAAGCAAGAGG + Intronic
1004304569 6:14488196-14488218 TCCTGAGACCAGGAAGAATAAGG - Intergenic
1004520912 6:16359731-16359753 TCCTGCGTCCAGAAAGAATGAGG - Intronic
1004720755 6:18265744-18265766 TCCTGTGTCCAGGAAGAGTGAGG + Intergenic
1005021405 6:21422916-21422938 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1005043428 6:21620086-21620108 TCCTTCGTTCAGGAAGAATGAGG + Intergenic
1005460863 6:26068654-26068676 TCCTGCATCCAGGAAGAATTAGG - Intergenic
1005658461 6:27967575-27967597 ACCTGTGTCCAGGAAGAATGAGG + Intergenic
1005803224 6:29447841-29447863 TCCAGTGTCAAGGAGGAATGGGG - Intronic
1006154344 6:32006227-32006249 TCCAGTGACCTGGAGGATTGGGG - Intergenic
1006225943 6:32536032-32536054 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1006867554 6:37221737-37221759 TTCTGTGTCCAAGATGAATGAGG + Intronic
1007501399 6:42300534-42300556 TGCTATGTGCTAGAAGAATGAGG - Intronic
1009241660 6:61193096-61193118 TCCTACATCCAGGAAGAATGAGG + Intergenic
1009537578 6:64908530-64908552 TCCAGTGTCCAAGAAGAATGAGG + Intronic
1009610104 6:65930654-65930676 TCCTGTGATCAGGAGGAATGAGG + Intergenic
1009643049 6:66362474-66362496 TCATGTGTCCAGGAAGGATGAGG + Intergenic
1010294736 6:74182803-74182825 TCCAGTGTCCAAGAAGGATGAGG - Intergenic
1010327516 6:74581979-74582001 TCTGGTGTCCAGGAAGAATCAGG + Intergenic
1010559702 6:77333940-77333962 TCCCATGTCCAAGAAGAATGAGG - Intergenic
1010733243 6:79412930-79412952 TCCAGTGTCCAGGAAGAACAAGG + Intergenic
1010736618 6:79450774-79450796 TCCAGTGTCCAGGAAAAATGAGG - Intergenic
1010846932 6:80720584-80720606 TCCCCTATCCAGGAAGAATGAGG - Intergenic
1011104282 6:83761830-83761852 GCCTTTGCCCTGGAAAAATGGGG - Intergenic
1011491808 6:87900657-87900679 TCTGGTGTCCAGGAAGAATCAGG + Intergenic
1011530082 6:88312111-88312133 TCCTGCAACCAGGAAGAATGAGG + Intergenic
1011882378 6:92045772-92045794 ACCTGTGCACTGGGAGAATGGGG + Intergenic
1012122426 6:95384777-95384799 TCCTGCATCCAGAAAGAATGAGG - Intergenic
1012141950 6:95636005-95636027 TCCTGCATCTAGGAAGAATGAGG + Intergenic
1012169511 6:96001707-96001729 TCCTGCATCCAGGACGAATGAGG + Intergenic
1012316872 6:97791524-97791546 TTCTGTGTCCAAGAAGAATGAGG + Intergenic
1012749480 6:103139956-103139978 TCCTACATCCAGGAAGAATGAGG + Intergenic
1012752826 6:103184591-103184613 CCCTGTGCCCAGGAAGAAAGTGG - Intergenic
1012795198 6:103750759-103750781 GCCTGTGCACTGGGAGAATGGGG + Intergenic
1013086313 6:106860915-106860937 TCCCGTGTCCAGGAAGAATGAGG + Intergenic
1013195280 6:107839208-107839230 ACCTGAGCCCTGGAAGACTGAGG + Intergenic
1013235990 6:108198348-108198370 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1013375604 6:109510718-109510740 TCCTGCATCCAGGAAGAATGAGG - Intronic
1013709369 6:112879717-112879739 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1013899146 6:115132078-115132100 TCCTGTGTCCAAGAAGAATGAGG - Intergenic
1014018911 6:116565775-116565797 TCCTTCGTCCAGAAAGAATGAGG + Intergenic
1014334582 6:120116934-120116956 ACTTGTGTCCTGGAAGTAGGAGG + Intergenic
1014384778 6:120786550-120786572 TCCCACGTCCTGGAATAATGAGG - Intergenic
1014505299 6:122247740-122247762 TCTTGTGTCCAGGAAGAATGAGG + Intergenic
1014662759 6:124193681-124193703 TTCTGTGACCAGGAAGAACGAGG + Intronic
1014674721 6:124349328-124349350 GCCTGTGCACTGGGAGAATGGGG - Intronic
1014770536 6:125453764-125453786 TCCCGTGTCCAGGAAGAATGAGG - Intergenic
1014888991 6:126818857-126818879 ACTTATGTTCTGGAAGAATGTGG - Intergenic
1014992836 6:128103331-128103353 TCTGGTGTCCAGGAAGAATCAGG - Intronic
1015096163 6:129417189-129417211 TCCCACATCCTGGAAGAATGAGG + Intronic
1015143366 6:129959290-129959312 TCCTGCATCAGGGAAGAATGAGG - Intergenic
1015215910 6:130749638-130749660 TCCCGTGTCCAAGAAGAATGAGG + Intergenic
1015348987 6:132194941-132194963 TCCAGCATCCTGGAAGAATCAGG + Intergenic
1015434795 6:133173069-133173091 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1015455594 6:133423887-133423909 TCCTGCATCCAGGAAGAATGAGG + Intronic
1016076702 6:139804740-139804762 TCCTGCGTCCAGGAAGAATGAGG + Intergenic
1016200065 6:141395453-141395475 TCCTGCAACCAGGAAGAATGAGG - Intergenic
1016210888 6:141531959-141531981 TTCCATGTCCAGGAAGAATGAGG - Intergenic
1016237916 6:141890550-141890572 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1016339625 6:143049193-143049215 TCCTGCATCTGGGAAGAATGAGG + Intergenic
1017047015 6:150356344-150356366 TCCAGAGTCCAAGAAGAATGTGG + Intergenic
1017396237 6:154002788-154002810 TCCCATGTCCATGAAGAATGAGG + Intergenic
1017587988 6:155947669-155947691 TCTTGCATCCAGGAAGAATGAGG - Intergenic
1018064899 6:160118037-160118059 TCCTGCGTCCAGGAAGAATAAGG + Intergenic
1018561203 6:165102504-165102526 TCCTGTGACCAAGAGGAATGAGG - Intergenic
1018803102 6:167238430-167238452 TTCAGTGTCCAGGAAGAATCAGG - Intergenic
1018831070 6:167444023-167444045 TCCAGCGTCCAGGAAGAATCGGG + Intergenic
1019296020 7:275818-275840 TCCTGCATCCAGGGAGAATGAGG + Intergenic
1019897857 7:3997231-3997253 TCTTGTATCCAGGAAGAATAAGG + Intronic
1020025190 7:4894819-4894841 TTCCGTGTCCAGGAAGAATCAGG + Intergenic
1020474791 7:8582365-8582387 TCCTGTGACCAGGAAGAATGAGG + Intronic
1020567967 7:9822040-9822062 TCCTGCATACAGGAAGAATGAGG + Intergenic
1020586839 7:10079426-10079448 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1020649318 7:10855410-10855432 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1020812398 7:12863681-12863703 CCCTGAGTTCAGGAAGAATGAGG + Intergenic
1020990722 7:15192562-15192584 TCCAGTGTCCGGGAAGAATCAGG - Intergenic
1021004644 7:15378908-15378930 TGCTGTGGTCTGAAAGAATGTGG - Intronic
1021097303 7:16548249-16548271 TCCTACATCCAGGAAGAATGAGG - Intronic
1021343069 7:19488625-19488647 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1021420800 7:20443014-20443036 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
1021431082 7:20559845-20559867 TCCCATGCCCAGGAAGAATGAGG + Intergenic
1021500717 7:21329649-21329671 TCCTCCATCCAGGAAGAATGAGG + Intergenic
1021560522 7:21964831-21964853 TCCGGAGTCCAGGAAGAATCAGG - Intergenic
1021561336 7:21971660-21971682 TCCTGTGTCCAGGAAGAAAGAGG + Intergenic
1021677727 7:23097823-23097845 TCCTGAATCCAGGAAGAATGAGG - Intergenic
1021787421 7:24165428-24165450 TCCTGCATCCAGTAAGAATGAGG + Intergenic
1022229554 7:28400682-28400704 TTCTGTGTCATGTAAGAACGAGG + Intronic
1022423376 7:30245529-30245551 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1022679611 7:32532017-32532039 TCCAGCGTCCAGGAAAAATGAGG + Intronic
1023500475 7:40844305-40844327 TCCAGTGTCCAGGAAGAATCAGG + Intronic
1023529234 7:41136165-41136187 TCCTGTGCCCAGGAAGAATTAGG + Intergenic
1023699472 7:42878227-42878249 TCCTGTGACCAGGAAGAATGAGG - Intergenic
1023699974 7:42883142-42883164 TCCTGTATCCAGGAAGAATGAGG + Intergenic
1023789193 7:43738211-43738233 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1024862540 7:53862163-53862185 TCCGGTGTCCGGGAGAAATGAGG + Intergenic
1026359537 7:69591005-69591027 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1026674864 7:72419983-72420005 TTCAGTGTCCAGGAAGAATCAGG - Intronic
1027333660 7:77126382-77126404 TCCTGCATCCAGGAAGAATGAGG + Intronic
1027569571 7:79847329-79847351 TCTGGTGTCCAGGAAGAATCAGG - Intergenic
1027734861 7:81920103-81920125 TCCTGTGTCCATGGAGAATGAGG + Intergenic
1027779787 7:82507259-82507281 TCCTGCGACCAGGAAGAAAGTGG + Intergenic
1027795740 7:82691288-82691310 TCCTGTGTCCTAGAAAAATGAGG + Intergenic
1027911874 7:84261292-84261314 TTCAGTGTCCAGGAAGAATGAGG - Intronic
1027924890 7:84447709-84447731 TCCCATGTCCAGGAAGAATGAGG - Intronic
1028053030 7:86208304-86208326 TCTTGTATCCAGGAAAAATGAGG + Intergenic
1028111824 7:86950259-86950281 TCCTATATCCAGGAAGAATGAGG - Intronic
1028128944 7:87147516-87147538 TCCTGCATCCAGGAAAAATGAGG + Intergenic
1028136819 7:87231006-87231028 TCCCATGTACAGGAAGAATGAGG - Intergenic
1028401903 7:90433599-90433621 TCTCATGTCCAGGAAGAATGAGG + Intronic
1028527347 7:91800956-91800978 TCCTGCATCTAGGAAGAATGAGG + Intronic
1028530379 7:91831920-91831942 TCCGGCGTCCAGGAAGAATCAGG + Intronic
1028531411 7:91842464-91842486 TCTGGTGTCCAGGAAGAATCAGG - Intronic
1028640833 7:93040174-93040196 TCTTGCATCCAGGAAGAATGAGG - Intergenic
1028999586 7:97139170-97139192 TCCTGTGTCCAAGAAGAATGAGG + Intronic
1029007993 7:97230399-97230421 TCCAGTGTCCCAGAAGAATAGGG - Intergenic
1029017297 7:97327600-97327622 TCCAGCGTCCAGGAAGAATCAGG - Intergenic
1029293488 7:99520208-99520230 TCCTTCATCCTGGAGGAATGGGG + Exonic
1029327696 7:99823916-99823938 TCCTTCGACCAGGAAGAATGAGG - Intergenic
1029782133 7:102744950-102744972 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1030149272 7:106386798-106386820 TCCTGTGACCAGGAAGAATGAGG - Intergenic
1030359504 7:108580128-108580150 TCCCATGTCCAGGAAGAATGAGG - Intergenic
1030386137 7:108870485-108870507 TTCAGTGTCCAGGAGGAATGAGG + Intergenic
1030387183 7:108878302-108878324 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
1030514000 7:110519021-110519043 TCCTGTGCCCAGGAAGAATGAGG + Intergenic
1030756388 7:113292004-113292026 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1030787854 7:113684613-113684635 TCCAGTGTCTTAGAAGAATGAGG + Intergenic
1030963095 7:115951636-115951658 TAGTGTGTCCTGGAAGTAGGGGG + Intronic
1030981054 7:116185933-116185955 TCCTGCGTCCAGAAAGAATGAGG + Intergenic
1031003534 7:116445744-116445766 TACTGTGTCCTTGAAGAATCAGG + Intronic
1031248698 7:119351066-119351088 ACCTGTGACCAGGAAGAATGAGG - Intergenic
1031743666 7:125467770-125467792 TCCTGCATCCGGGAAGAATGAGG + Intergenic
1031786650 7:126041386-126041408 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1031921911 7:127608615-127608637 TCCCATGTCCAGGAAGAATGAGG + Intergenic
1032250885 7:130256328-130256350 ACCTGTGCACTGGGAGAATGGGG + Intergenic
1032345158 7:131110025-131110047 TGCTGTGTCATGCAAGAAGGAGG + Intergenic
1032538779 7:132686187-132686209 TCCTGTGTCCAAGAAGAATGAGG - Intronic
1032858557 7:135857654-135857676 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1032917575 7:136509769-136509791 TCTGGTGTCCAGGAAAAATGAGG + Intergenic
1033573331 7:142655599-142655621 CCCAGCGTCCTGGAAGAATTGGG - Intergenic
1033967362 7:146992612-146992634 GCCTGTGTACAGGGAGAATGGGG - Intronic
1034210351 7:149357792-149357814 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1034215872 7:149405169-149405191 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1034252139 7:149701239-149701261 TCCCATGTCCAGGAAGATTGAGG + Intergenic
1034267652 7:149789051-149789073 GCCTGTGGCCTGGAGGGATGAGG + Intergenic
1034284477 7:149875465-149875487 TCCTGTGTCCAGGAGGCATCAGG + Intronic
1034406357 7:150905394-150905416 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1034571325 7:151958767-151958789 TCCTGCGTCCAAGAAGAATGAGG + Intronic
1034998079 7:155590973-155590995 TCCAGTGCCCAGGAAGAATCAGG + Intergenic
1035252335 7:157605551-157605573 TTCTGCGACCAGGAAGAATGAGG + Intronic
1035418408 7:158707700-158707722 TCCCATGTCCAGGAAGAATGAGG + Intergenic
1035434493 7:158849468-158849490 TCCTGCATCTGGGAAGAATGAGG + Intergenic
1035451047 7:158977039-158977061 TCCTGCGTCTAGGAAGAATGAGG - Intergenic
1036082104 8:5568190-5568212 TCCTGTGTTCAAGGAGAATGAGG + Intergenic
1036095114 8:5715594-5715616 TCCTGTGACATGTAACAATGTGG - Intergenic
1036155588 8:6339202-6339224 GCCTGTGCACTGGGAGAATGGGG + Intergenic
1036907694 8:12720851-12720873 CCCTGCATCCAGGAAGAATGAGG - Intergenic
1036915405 8:12799466-12799488 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1037472999 8:19229035-19229057 TCCAGCGTCCAAGAAGAATGAGG + Intergenic
1037594482 8:20343450-20343472 TCCAGTGCCCAAGAAGAATGAGG + Intergenic
1038149387 8:24928655-24928677 TCTTGTGTACAGGAAGAATGAGG - Intergenic
1038215965 8:25561993-25562015 TCTGGTGTCCAAGAAGAATGAGG + Intergenic
1038486290 8:27937426-27937448 TCCTGGGTCCTGGGGGCATGAGG + Intronic
1038725633 8:30080009-30080031 TCCTGAGATGTGGAAGAATGTGG - Intronic
1038931858 8:32202565-32202587 TTCAGTGTCCATGAAGAATGAGG + Intronic
1038963026 8:32542708-32542730 TCCAGTGCCCTTGAAGAAGGAGG - Intronic
1039182257 8:34880086-34880108 TCCTTCGTTCAGGAAGAATGAGG + Intergenic
1039228767 8:35419807-35419829 TCCTGTGTCCAAGAAGAATGAGG + Intronic
1039416175 8:37395977-37395999 TCCTGGGGCCTAGGAGAATGTGG + Intergenic
1039494914 8:37973453-37973475 TCCTGCATCCAAGAAGAATGAGG + Intergenic
1040509436 8:48081148-48081170 TCCTGTGTCCAAGAAGAATGAGG - Intergenic
1040538708 8:48332224-48332246 TCCTCTGTCCAAGAATAATGAGG + Intergenic
1040725584 8:50378499-50378521 TGCTGTGACCAGGAAAAATGAGG + Intronic
1041205448 8:55494477-55494499 TCCTGCATCCAGGAAGAATGAGG + Intronic
1041274469 8:56142895-56142917 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1041328824 8:56700308-56700330 GCCTGGGTCCTGGATCAATGAGG + Intergenic
1041627125 8:60043085-60043107 TCCTTTATCCTGCAATAATGTGG - Intergenic
1041965425 8:63669892-63669914 TCTCATGTCCAGGAAGAATGAGG + Intergenic
1041983751 8:63894822-63894844 TACTGTGCCCAAGAAGAATGAGG + Intergenic
1041988386 8:63954559-63954581 CCCAGCGTCCAGGAAGAATGAGG + Intergenic
1042004426 8:64165664-64165686 TCCAGTGTCCAGGAGGAATGAGG - Intergenic
1042196772 8:66237827-66237849 TCCTGTGTCCAGGAAGAACAAGG + Intergenic
1042336988 8:67639782-67639804 TCCTGTGTCCAGGAAGAATGAGG + Intronic
1042396131 8:68293415-68293437 TCCTGTGTTCCGGAAGAATGAGG - Intergenic
1042583023 8:70303410-70303432 TCCAGTGTCATTGAACAATGGGG - Intronic
1042601427 8:70503099-70503121 TCCAGTGTCCAGGAAGAATCAGG + Intergenic
1042609062 8:70577595-70577617 TCCTGCATCCAGGAAGAATGAGG - Intronic
1042687795 8:71461679-71461701 TCCTGAGACCAAGAAGAATGAGG + Intronic
1043082485 8:75784174-75784196 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1043087109 8:75849041-75849063 TCCTGCAACCAGGAAGAATGAGG + Intergenic
1043195604 8:77288086-77288108 TCCAGTGTCCAGGAGGAATGAGG - Intergenic
1043695260 8:83208958-83208980 TCCCATATCCAGGAAGAATGAGG - Intergenic
1044091715 8:88010662-88010684 TCCTGTGCCCAAGAAGAATGAGG + Intergenic
1044259090 8:90097491-90097513 TCCTGCACCCAGGAAGAATGAGG + Intergenic
1044325443 8:90852858-90852880 TCCAGTGTTCAGGAAAAATGAGG - Intronic
1044613942 8:94120345-94120367 TCCTGCATCCAGGAGGAATGAGG - Intergenic
1045084807 8:98670875-98670897 TCCCATGTCCAAGAAGAATGAGG - Intronic
1046249620 8:111612438-111612460 TACTGTGTCCAGGAAGAATGAGG + Intergenic
1046459675 8:114517691-114517713 TGCTGTGTCCAGGACGAATGAGG + Intergenic
1046915952 8:119678578-119678600 TACTGAGGCCTGGGAGAATGAGG - Intergenic
1047104624 8:121719593-121719615 TCCTGTGACCAAGAAGAATGAGG + Intergenic
1047253733 8:123200272-123200294 TCCGGTGTTCTGGAAGAAGGTGG - Intronic
1047318308 8:123754702-123754724 TCCCATGTCCAAGAAGAATGAGG + Intergenic
1048205700 8:132413705-132413727 TGCTCTGTTCTGGAAGAAAGGGG - Intronic
1048339063 8:133525078-133525100 TACCATGTCCAGGAAGAATGAGG + Intronic
1048355391 8:133649657-133649679 TCCTTAGTCCTGGAATAAAGAGG + Intergenic
1048439622 8:134450396-134450418 TCCAGTGTCCAGGAGGAATCCGG - Intergenic
1048616069 8:136076794-136076816 TCCAGTGCCCAAGAAGAATGAGG + Intergenic
1048680083 8:136831763-136831785 CCCAGTGTCCAGGAAGAATCAGG + Intergenic
1048687456 8:136919807-136919829 TCCCATGTCCAAGAAGAATGAGG + Intergenic
1048712398 8:137226884-137226906 TCCTGCATCCAAGAAGAATGAGG + Intergenic
1049021806 8:139962189-139962211 TCCTGCATCCAGGAAGACTGAGG - Intronic
1049140543 8:140950147-140950169 TCCAGTGTCCAGGAAGAATGAGG - Intronic
1049824078 8:144655721-144655743 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1050130547 9:2407261-2407283 TACTGTGACCAGGAAGAATGAGG - Intergenic
1050182387 9:2934771-2934793 TCCTGCATACAGGAAGAATGAGG - Intergenic
1050237553 9:3597752-3597774 TCTGGTGTCCAAGAAGAATGAGG - Intergenic
1050484020 9:6114952-6114974 TCCTGCACCCAGGAAGAATGAGG - Intergenic
1050673635 9:8026795-8026817 TTCTCTGTCCTGGAAGAAGATGG - Intergenic
1050718799 9:8561430-8561452 TCCTGCGTCCAAGAAAAATGAGG - Intronic
1050725555 9:8644406-8644428 TCCTGTGACCAGGAAGAATGAGG - Intronic
1050808937 9:9719298-9719320 TCCCATGTCCAAGAAGAATGAGG - Intronic
1050829127 9:9989624-9989646 TCCAGTGTCCAGGAGGAATGAGG - Intronic
1050942036 9:11472045-11472067 CCCTGTATCAAGGAAGAATGAGG - Intergenic
1051001799 9:12291031-12291053 TCCTGAATCCAGGAAGAATGAGG - Intergenic
1051263494 9:15288626-15288648 TCCAGTGTCCAGGAAGAATCAGG - Intronic
1051355253 9:16234626-16234648 TTCTGTGTCCGGGAAGAATAAGG - Intronic
1051681963 9:19616715-19616737 TCCTGTATCCTGGCAGAAACAGG + Intronic
1051986112 9:23089376-23089398 TCCTGTGTCCAAGAAGAAAGAGG + Intergenic
1052059265 9:23941210-23941232 GCCTGTGCACTGGGAGAATGGGG - Intergenic
1052116058 9:24649485-24649507 TCCCATGTCCAGGAAGAATGAGG - Intergenic
1052437184 9:28444142-28444164 TCCCATATCCAGGAAGAATGAGG - Intronic
1052520750 9:29545963-29545985 GCCTGAGAACTGGAAGAATGGGG - Intergenic
1052552494 9:29969386-29969408 TCCTGCAACCAGGAAGAATGAGG + Intergenic
1052580577 9:30349508-30349530 TTCTGCGTCCAGGAAGAATGAGG + Intergenic
1052633499 9:31071273-31071295 TCCTGTGGTCAGGAAGAATGAGG + Intergenic
1052654192 9:31334711-31334733 TCCTGTGTCCAGGAAGACTGAGG + Intergenic
1052691507 9:31821395-31821417 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1052708002 9:32016312-32016334 TCCTGTGCCTGGGAAGAATGAGG + Intergenic
1052885935 9:33647999-33648021 CCCAGTGTCCTGGAAGAATTGGG - Intergenic
1053445110 9:38146662-38146684 TCCTGCATCCAGAAAGAATGAGG - Intergenic
1053593462 9:39534941-39534963 TCCTGTCTCAGGGATGAATGTGG - Intergenic
1053617444 9:39782176-39782198 TCCTGCATCCAGGAGGAATGAGG - Intergenic
1053851196 9:42289649-42289671 TCCTGTCTCAGGGATGAATGTGG - Intergenic
1053875627 9:42541535-42541557 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1053897021 9:42753094-42753116 TCCTGCATCCAGGAGGAATGAGG + Intergenic
1054236072 9:62560189-62560211 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1054266722 9:62925261-62925283 TCCTGCATCCAGGAGGAATGAGG + Intergenic
1054550215 9:66594715-66594737 TCCTGCATCCAGGAGGAATGAGG + Intergenic
1054572844 9:66830336-66830358 TCCTGTCTCAGGGATGAATGTGG + Intergenic
1055230483 9:74058207-74058229 TCCTGTGTCCAAGAAGAATGAGG - Intergenic
1055645503 9:78358070-78358092 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1056084183 9:83128673-83128695 TCCTGTGTCCAAGAAGAATGAGG - Intergenic
1056191976 9:84194007-84194029 TCCTGCATCCAGGAAGAATGGGG + Intergenic
1056462211 9:86818843-86818865 TCCCGTGTCCAGGAAGAATGAGG - Intergenic
1056986183 9:91365098-91365120 TCCTGGGTCCAGGAAGAATGAGG - Intergenic
1057468620 9:95338184-95338206 TCCTGTGACCAGGAAGAATGAGG - Intergenic
1057510771 9:95678127-95678149 TCCTGCATTCAGGAAGAATGAGG + Intergenic
1057523062 9:95775431-95775453 TCCTGTGACCAGCAAAAATGCGG + Intergenic
1057531255 9:95848217-95848239 TCCTGGATCCAGGAAGAGTGAGG - Intergenic
1057542782 9:95990847-95990869 TCTGGTGTCCAGGAAGAATCAGG + Intronic
1057542853 9:95991286-95991308 TTCTTTTTCCTGCAAGAATGTGG - Intronic
1058077741 9:100667857-100667879 TCCTGTGTCAAGGAAGAATGAGG - Intergenic
1058091991 9:100814879-100814901 TACTGCATCCAGGAAGAATGAGG - Intergenic
1058280187 9:103103961-103103983 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1058487671 9:105458411-105458433 TCCTGCGTCCAGGAAGAATGAGG + Intronic
1058545716 9:106059007-106059029 TTCTGCATCCAGGAAGAATGAGG + Intergenic
1059104862 9:111502241-111502263 TCCTATATGCAGGAAGAATGAGG - Intergenic
1059232334 9:112732723-112732745 TCCTGTGTCCAGGTAGAAGAAGG + Intergenic
1059401288 9:114072021-114072043 TCCTGTGACCAGAAAGAATGAGG - Intronic
1059566383 9:115386305-115386327 TCCTGCATCTAGGAAGAATGAGG - Intronic
1059852869 9:118363724-118363746 TCTTGAGTCCAGGAAGAATGAGG - Intergenic
1060618854 9:125044605-125044627 TCCTGCGCCCAGGAAGAATGAGG - Intronic
1061044219 9:128155854-128155876 TCCGGAGTCCAAGAAGAATGAGG - Intergenic
1061182389 9:129032457-129032479 TCTAGTGTCCAAGAAGAATGAGG - Intergenic
1061743182 9:132722206-132722228 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1061764162 9:132870886-132870908 TCATGTGTCCTAGAAGAGTGCGG - Intronic
1062184784 9:135212220-135212242 TTCTGCTTCCAGGAAGAATGAGG - Intergenic
1062674476 9:137732372-137732394 TCTTGGGTCCAGGAAGAATGAGG + Intronic
1203758808 EBV:823-845 TCCTGTGTCCAGAAAACATGTGG - Intergenic
1203516018 Un_GL000213v1:2189-2211 TCCAGCGTCCAGGAAGAATCAGG - Intergenic
1203691570 Un_GL000214v1:47543-47565 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1203751823 Un_GL000218v1:87262-87284 TCCTGAGTCCAGGAAAAATGAGG - Intergenic
1203710497 Un_KI270742v1:93231-93253 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
1203540554 Un_KI270743v1:84223-84245 TCCTGAGTCCAGGAAGAATGAGG + Intergenic
1203644725 Un_KI270751v1:56648-56670 TCCTGAGTCCAGGAAGAATGAGG - Intergenic
1185551280 X:984188-984210 TCCAGCGTCCAAGAAGAATGAGG - Intergenic
1185738481 X:2511681-2511703 GTCAGTGTCCTGGAAGAATCAGG + Intergenic
1185936026 X:4257799-4257821 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
1186031766 X:5376219-5376241 TCCAGTGTCCAGGAAGAATCAGG - Intergenic
1186033200 X:5392194-5392216 TCCTGAGTCCAGGAGGAATGAGG + Intergenic
1186056454 X:5654618-5654640 TCTGGTGTCCAGGAAGAATGAGG + Intergenic
1186127088 X:6425946-6425968 TCCAGCGTCCAGGAGGAATGAGG + Intergenic
1186223574 X:7374873-7374895 TCTCGTCTCCAGGAAGAATGAGG + Intergenic
1187244952 X:17545693-17545715 TCCTGTTTGCTGTAGGAATGAGG + Intronic
1187555833 X:20350258-20350280 TCCTGTGTCCCCCAACAATGGGG - Intergenic
1188117552 X:26263746-26263768 TCCAGTGTCCGGGAAGAATCGGG + Intergenic
1188194985 X:27222454-27222476 TCCAATGTCCAGGAAGAATGAGG - Intergenic
1188390342 X:29611722-29611744 TCTGGTGTCCAGGAAGAATCAGG + Intronic
1188647933 X:32592601-32592623 TCCCATGTCCAGGAAGAATGAGG - Intronic
1188756578 X:33969874-33969896 TCCTGAATCCAGGAAGAATGAGG - Intergenic
1188859799 X:35243611-35243633 TCCTGTGACCAGGAAAAATGAGG + Intergenic
1189023940 X:37371395-37371417 TCCTTTATCCAGGAAGAATGAGG - Intronic
1189074223 X:37898932-37898954 TGCTGGGTCCTGAAAGAATGTGG - Intronic
1189083647 X:37998188-37998210 TCTTGTGACCAGGAAGAATGAGG - Intronic
1189360249 X:40344402-40344424 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1189450281 X:41122715-41122737 TCCTGTGTCTGGGAAGAATCAGG + Intronic
1189726400 X:43971362-43971384 TCCTGGGCCCTTGAAAAATGTGG - Intronic
1189856303 X:45228666-45228688 TCCTGTGACCGTGAAGAATGAGG + Intergenic
1190028470 X:46948306-46948328 ACCTTTGTCCTGGAATTATGTGG + Intronic
1190068804 X:47262276-47262298 TTCTATGTCCTGTAAAAATGGGG - Intergenic
1190125164 X:47698404-47698426 TCCAGTGCCCAAGAAGAATGAGG - Intergenic
1190483058 X:50897056-50897078 TCCCGCTTCCTGGAAGAATCGGG + Intergenic
1190487441 X:50941917-50941939 TCTTGTGTCCAAGAAGAATGAGG + Intergenic
1190549473 X:51563873-51563895 GCCTGTGAACTGGGAGAATGGGG - Intergenic
1190566134 X:51732198-51732220 TACAGTGTCCAGGAAGAATCAGG - Intergenic
1190620632 X:52284115-52284137 TCTTGTGTCCAGGAAGAAGGAGG + Intergenic
1191653292 X:63565588-63565610 TACTGTGCCATGGAAGAAGGTGG - Intergenic
1192267256 X:69547316-69547338 TCCTGCATCCAGGAAGAATGAGG - Intergenic
1192544952 X:72005547-72005569 TCCTGTCCCCTGGAAGTATTTGG - Intergenic
1193144586 X:78063971-78063993 TCAAGTGTCCAGGAAGAATCAGG + Intergenic
1193211397 X:78810857-78810879 TCCCATGTCCAGGAAGAATGAGG + Intergenic
1193468682 X:81874935-81874957 TCCTGTGACCAGGAAGAATGAGG + Intergenic
1193486075 X:82086654-82086676 TCTTGTGTCCAAGAAGAATGAGG + Intergenic
1193574973 X:83185587-83185609 TCCTGTGACCAGGAAAAATAAGG + Intergenic
1193807594 X:86013221-86013243 TCCTGTGTTCAGGAAGAATGAGG - Intronic
1194163358 X:90483339-90483361 TCCAGTGTCCAGGAAAAATCAGG + Intergenic
1194176194 X:90651313-90651335 TCCAGAGTCCAGGAAAAATGAGG + Intergenic
1194316170 X:92379892-92379914 ACCTGTGTCCAGGAAGAATGAGG - Intronic
1194380362 X:93182353-93182375 TCCTGCATCAAGGAAGAATGAGG - Intergenic
1194413134 X:93579398-93579420 TCCTGTGACCAGGAAGAATGAGG - Intergenic
1194891443 X:99384400-99384422 TCCCACGTCCAGGAAGAATGAGG + Intergenic
1195126576 X:101814373-101814395 TCCTGAGCCCAGGAAGAATGAGG - Intergenic
1195146070 X:102018518-102018540 TCCTGCATCCAAGAAGAATGAGG + Intergenic
1195178471 X:102333712-102333734 TCCTGTGCCCAGGAAGAATAAGG + Intergenic
1195180393 X:102353371-102353393 TCCTGTGCCCAGGAAGAATAAGG - Intergenic
1195454211 X:105050666-105050688 TCCCAGGTCCAGGAAGAATGAGG + Intronic
1195647544 X:107249658-107249680 TCCAGTGTCCAGGAAGAATCAGG + Intergenic
1195722435 X:107879252-107879274 TCCAGTGTCCAGGAGGAATGAGG + Intronic
1195854074 X:109311343-109311365 TCTGGTGTCCAAGAAGAATGAGG + Intergenic
1195858783 X:109358568-109358590 TCCAGTGTCCAGGAGAAATGAGG - Intergenic
1196242986 X:113365687-113365709 AGCTGTGTCCTGGCAGAAAGGGG - Intergenic
1196883615 X:120223068-120223090 TCCTGTGTCCAGGAAGAATGAGG + Intergenic
1196883621 X:120223140-120223162 TCCTGCATCCAGGAAGAATGAGG + Intergenic
1197120204 X:122881668-122881690 TTCTGTGTCTTGGATGAATTGGG - Intergenic
1197378468 X:125710297-125710319 GCCTATATCCAGGAAGAATGAGG - Intergenic
1197421335 X:126238909-126238931 TCCTGTATCCAGGAAAAATGAGG - Intergenic
1197527236 X:127577922-127577944 TCCTGCGTCCAGGAAGAATGAGG - Intergenic
1197609487 X:128622841-128622863 TCCTGCGTCCAGAACGAATGAGG + Intergenic
1197739259 X:129876680-129876702 TCCAGAATCCTGGAAGAATCAGG - Intergenic
1197795929 X:130298983-130299005 ACCTGTGTCCAGGAAGAATGAGG + Intergenic
1198184138 X:134237386-134237408 CCCTGTGTCCGGGAAGAAGAGGG - Intronic
1198237191 X:134746347-134746369 TCCTGTCTCTTGGGACAATGAGG - Intronic
1198613289 X:138425590-138425612 TCCAGTGTCCAGGAAGAATGAGG - Intergenic
1199092390 X:143706518-143706540 TCCTGTGTCCAGGAAGAATGAGG - Intergenic
1199187938 X:144938983-144939005 TCCTGTGTCTAGGAAGAATGAGG + Intergenic
1199337064 X:146630587-146630609 TCCAGTGTTCAGGAGGAATGAGG - Intergenic
1199432420 X:147776467-147776489 TTCAGTGTCCAGGAAGAATTAGG + Intergenic
1199614853 X:149648220-149648242 TCCTGTGACCAGGAAGAATGAGG - Intergenic
1200110547 X:153738572-153738594 ACCTGTGTCCTGACAGAAAGGGG - Intronic
1200183984 X:154169860-154169882 ACCTGTGTCCTGACAGAAAGGGG - Intergenic
1200189638 X:154206988-154207010 ACCTGTGTCCTGACAGAAAGGGG - Intergenic
1200195391 X:154244797-154244819 ACCTGTGTCCTGACAGAAAGGGG - Intergenic
1200201043 X:154281918-154281940 ACCTGTGTCCTGACAGAAAGGGG - Intronic
1200234572 X:154462040-154462062 TCCTGTGTCCCAGAAGAGAGCGG - Intronic
1200411715 Y:2868071-2868093 TCCTGCGTCCAGGAAGAATGAGG + Intronic
1200509627 Y:4061064-4061086 TCCAGTGTCCAGGAAAAATCAGG + Intergenic
1200522820 Y:4232258-4232280 TCCAGAGTCCAGGAAAAATGAGG + Intergenic
1200624214 Y:5491466-5491488 TCCTGTGTCCAGGAAGAATGAGG - Intronic
1201165477 Y:11204882-11204904 TCCTGAGTCCAGGAAAAATGAGG - Intergenic
1201320496 Y:12693500-12693522 TCCCGTGCCCAAGAAGAATGAGG + Intergenic
1201368413 Y:13234541-13234563 TCCTTTGGCAGGGAAGAATGAGG + Intergenic
1201580959 Y:15511800-15511822 ACCTGTAACCTGGAAGCATGTGG - Intergenic
1201701178 Y:16883802-16883824 TCATGTGTCCAGGAAGAATCAGG + Intergenic
1201780575 Y:17716923-17716945 TTCTGCTTCCAGGAAGAATGTGG + Intergenic
1201796971 Y:17906340-17906362 TTCTTTATCCAGGAAGAATGAGG - Intergenic
1201804582 Y:17999645-17999667 TTCTTTATCCAGGAAGAATGAGG + Intergenic
1201820979 Y:18189067-18189089 TTCTGCTTCCAGGAAGAATGTGG - Intergenic
1202138829 Y:21699677-21699699 TCCCATGTCCAGGAAAAATGAGG + Intergenic
1202170496 Y:22038615-22038637 TCCTGTTTGCAGGAAGAATGAGG - Intergenic
1202220868 Y:22547758-22547780 TCCTGTTTGCAGGAAGAATGAGG + Intergenic
1202322245 Y:23647905-23647927 TCCTGTTTGCAGGAAGAATGAGG - Intergenic
1202358344 Y:24075399-24075421 TTCTTTATCCAGGAAGAATGAGG - Intergenic
1202512434 Y:25594714-25594736 TTCTTTATCCAGGAAGAATGAGG + Intergenic
1202548523 Y:26022151-26022173 TCCTGTTTGCAGGAAGAATGAGG + Intergenic