ID: 978663369

View in Genome Browser
Species Human (GRCh38)
Location 4:111154221-111154243
Sequence ACCTCATTCTTCCAGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978663369_978663372 -6 Left 978663369 4:111154221-111154243 CCTGTGTCCTGGAAGAATGAGGT No data
Right 978663372 4:111154238-111154260 TGAGGTACGTGAACAAGTGGAGG No data
978663369_978663373 -5 Left 978663369 4:111154221-111154243 CCTGTGTCCTGGAAGAATGAGGT No data
Right 978663373 4:111154239-111154261 GAGGTACGTGAACAAGTGGAGGG No data
978663369_978663374 12 Left 978663369 4:111154221-111154243 CCTGTGTCCTGGAAGAATGAGGT No data
Right 978663374 4:111154256-111154278 GGAGGGTGAGCAAAGTGAAGAGG No data
978663369_978663371 -9 Left 978663369 4:111154221-111154243 CCTGTGTCCTGGAAGAATGAGGT No data
Right 978663371 4:111154235-111154257 GAATGAGGTACGTGAACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978663369 Original CRISPR ACCTCATTCTTCCAGGACAC AGG (reversed) Intergenic
No off target data available for this crispr