ID: 978663372

View in Genome Browser
Species Human (GRCh38)
Location 4:111154238-111154260
Sequence TGAGGTACGTGAACAAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978663364_978663372 23 Left 978663364 4:111154192-111154214 CCAACATTCAGCAGGTCCTGAGG No data
Right 978663372 4:111154238-111154260 TGAGGTACGTGAACAAGTGGAGG No data
978663363_978663372 24 Left 978663363 4:111154191-111154213 CCCAACATTCAGCAGGTCCTGAG No data
Right 978663372 4:111154238-111154260 TGAGGTACGTGAACAAGTGGAGG No data
978663369_978663372 -6 Left 978663369 4:111154221-111154243 CCTGTGTCCTGGAAGAATGAGGT No data
Right 978663372 4:111154238-111154260 TGAGGTACGTGAACAAGTGGAGG No data
978663366_978663372 7 Left 978663366 4:111154208-111154230 CCTGAGGTCTTGTCCTGTGTCCT No data
Right 978663372 4:111154238-111154260 TGAGGTACGTGAACAAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978663372 Original CRISPR TGAGGTACGTGAACAAGTGG AGG Intergenic
No off target data available for this crispr