ID: 978663374

View in Genome Browser
Species Human (GRCh38)
Location 4:111154256-111154278
Sequence GGAGGGTGAGCAAAGTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978663366_978663374 25 Left 978663366 4:111154208-111154230 CCTGAGGTCTTGTCCTGTGTCCT No data
Right 978663374 4:111154256-111154278 GGAGGGTGAGCAAAGTGAAGAGG No data
978663370_978663374 5 Left 978663370 4:111154228-111154250 CCTGGAAGAATGAGGTACGTGAA No data
Right 978663374 4:111154256-111154278 GGAGGGTGAGCAAAGTGAAGAGG No data
978663369_978663374 12 Left 978663369 4:111154221-111154243 CCTGTGTCCTGGAAGAATGAGGT No data
Right 978663374 4:111154256-111154278 GGAGGGTGAGCAAAGTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978663374 Original CRISPR GGAGGGTGAGCAAAGTGAAG AGG Intergenic