ID: 978669479

View in Genome Browser
Species Human (GRCh38)
Location 4:111228788-111228810
Sequence CTGAACCAGGAGAAGCAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978669479_978669481 4 Left 978669479 4:111228788-111228810 CCAGTCTGCTTCTCCTGGTTCAG No data
Right 978669481 4:111228815-111228837 TGAAATCTTGCTTCCATCCCTGG No data
978669479_978669485 24 Left 978669479 4:111228788-111228810 CCAGTCTGCTTCTCCTGGTTCAG No data
Right 978669485 4:111228835-111228857 TGGATTTTGAACCTTAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978669479 Original CRISPR CTGAACCAGGAGAAGCAGAC TGG (reversed) Intergenic
No off target data available for this crispr