ID: 978677498

View in Genome Browser
Species Human (GRCh38)
Location 4:111337243-111337265
Sequence GTGCCGTTTTTTAAGCTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978677498_978677501 3 Left 978677498 4:111337243-111337265 CCGACCAGCTTAAAAAACGGCAC No data
Right 978677501 4:111337269-111337291 ACGAGATTGTATCCCGCACCTGG No data
978677498_978677504 12 Left 978677498 4:111337243-111337265 CCGACCAGCTTAAAAAACGGCAC No data
Right 978677504 4:111337278-111337300 TATCCCGCACCTGGCTTGGAGGG 0: 145
1: 854
2: 1669
3: 1660
4: 1049
978677498_978677503 11 Left 978677498 4:111337243-111337265 CCGACCAGCTTAAAAAACGGCAC No data
Right 978677503 4:111337277-111337299 GTATCCCGCACCTGGCTTGGAGG No data
978677498_978677502 8 Left 978677498 4:111337243-111337265 CCGACCAGCTTAAAAAACGGCAC No data
Right 978677502 4:111337274-111337296 ATTGTATCCCGCACCTGGCTTGG 0: 19
1: 682
2: 1298
3: 1122
4: 641
978677498_978677508 26 Left 978677498 4:111337243-111337265 CCGACCAGCTTAAAAAACGGCAC No data
Right 978677508 4:111337292-111337314 CTTGGAGGGTCCTACGCCCACGG 0: 187
1: 1248
2: 1570
3: 1067
4: 820

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978677498 Original CRISPR GTGCCGTTTTTTAAGCTGGT CGG (reversed) Intergenic
No off target data available for this crispr