ID: 978682552

View in Genome Browser
Species Human (GRCh38)
Location 4:111399399-111399421
Sequence CATCTCTACTTGGGTAAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978682552_978682555 23 Left 978682552 4:111399399-111399421 CCGATTTTACCCAAGTAGAGATG No data
Right 978682555 4:111399445-111399467 AATGTTTTGTATTAAGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978682552 Original CRISPR CATCTCTACTTGGGTAAAAT CGG (reversed) Intergenic
No off target data available for this crispr