ID: 978689023

View in Genome Browser
Species Human (GRCh38)
Location 4:111484148-111484170
Sequence CCTTGGGCACCCCAGTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978689014_978689023 15 Left 978689014 4:111484110-111484132 CCACCCATTGTAGTGTAGTGACC No data
Right 978689023 4:111484148-111484170 CCTTGGGCACCCCAGTGCAGTGG No data
978689015_978689023 12 Left 978689015 4:111484113-111484135 CCCATTGTAGTGTAGTGACCAGA No data
Right 978689023 4:111484148-111484170 CCTTGGGCACCCCAGTGCAGTGG No data
978689016_978689023 11 Left 978689016 4:111484114-111484136 CCATTGTAGTGTAGTGACCAGAG No data
Right 978689023 4:111484148-111484170 CCTTGGGCACCCCAGTGCAGTGG No data
978689018_978689023 -6 Left 978689018 4:111484131-111484153 CCAGAGGCCTGAGAGTACCTTGG No data
Right 978689023 4:111484148-111484170 CCTTGGGCACCCCAGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978689023 Original CRISPR CCTTGGGCACCCCAGTGCAG TGG Intergenic
No off target data available for this crispr