ID: 978691921

View in Genome Browser
Species Human (GRCh38)
Location 4:111523906-111523928
Sequence CAGCAAATGGATGCGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978691921_978691927 25 Left 978691921 4:111523906-111523928 CCTCCAGCCGCATCCATTTGCTG No data
Right 978691927 4:111523954-111523976 TATGGCTCCATAGTATTCCATGG 0: 109
1: 25467
2: 14009
3: 8159
4: 5379
978691921_978691926 7 Left 978691921 4:111523906-111523928 CCTCCAGCCGCATCCATTTGCTG No data
Right 978691926 4:111523936-111523958 CATTACTTCATTCTTTTTTATGG 0: 7
1: 232
2: 2470
3: 7062
4: 17879

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978691921 Original CRISPR CAGCAAATGGATGCGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr