ID: 978702567

View in Genome Browser
Species Human (GRCh38)
Location 4:111666120-111666142
Sequence TCTTATCTTTTGATGGTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978702567_978702574 28 Left 978702567 4:111666120-111666142 CCAATCACCATCAAAAGATAAGA No data
Right 978702574 4:111666171-111666193 ACCAGGATATGAAAGACAGTAGG No data
978702567_978702570 11 Left 978702567 4:111666120-111666142 CCAATCACCATCAAAAGATAAGA No data
Right 978702570 4:111666154-111666176 TCGCCTCCCAAAAGTGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978702567 Original CRISPR TCTTATCTTTTGATGGTGAT TGG (reversed) Intergenic
No off target data available for this crispr