ID: 978707749

View in Genome Browser
Species Human (GRCh38)
Location 4:111735850-111735872
Sequence GGTACCAAACTAGAACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978707745_978707749 17 Left 978707745 4:111735810-111735832 CCTTGTCAATAAAGATTTTACAT No data
Right 978707749 4:111735850-111735872 GGTACCAAACTAGAACAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978707749 Original CRISPR GGTACCAAACTAGAACAAGC AGG Intergenic
No off target data available for this crispr