ID: 978710695

View in Genome Browser
Species Human (GRCh38)
Location 4:111777061-111777083
Sequence CTTCATGACAATCAGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978710695_978710696 12 Left 978710695 4:111777061-111777083 CCTCTCTTCTGATTGTCATGAAG No data
Right 978710696 4:111777096-111777118 AGATCACCACTGAACTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978710695 Original CRISPR CTTCATGACAATCAGAAGAG AGG (reversed) Intergenic
No off target data available for this crispr