ID: 978714986

View in Genome Browser
Species Human (GRCh38)
Location 4:111831343-111831365
Sequence TGGTACCATATCCATTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978714986_978714993 25 Left 978714986 4:111831343-111831365 CCACTCCAATGGATATGGTACCA No data
Right 978714993 4:111831391-111831413 CAGAGCCAGTGAAAAAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978714986 Original CRISPR TGGTACCATATCCATTGGAG TGG (reversed) Intergenic
No off target data available for this crispr