ID: 978716328

View in Genome Browser
Species Human (GRCh38)
Location 4:111847417-111847439
Sequence ACATCTGGAAACTTTGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978716328_978716332 -5 Left 978716328 4:111847417-111847439 CCCAGATCAAAGTTTCCAGATGT No data
Right 978716332 4:111847435-111847457 GATGTCTTTACAAAACTGTAGGG No data
978716328_978716331 -6 Left 978716328 4:111847417-111847439 CCCAGATCAAAGTTTCCAGATGT No data
Right 978716331 4:111847434-111847456 AGATGTCTTTACAAAACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978716328 Original CRISPR ACATCTGGAAACTTTGATCT GGG (reversed) Intergenic
No off target data available for this crispr