ID: 978732650

View in Genome Browser
Species Human (GRCh38)
Location 4:112048210-112048232
Sequence CTCTGGCTAATAAGGTAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978732647_978732650 28 Left 978732647 4:112048159-112048181 CCATAAAGCAAGTTTTAATAAAT No data
Right 978732650 4:112048210-112048232 CTCTGGCTAATAAGGTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978732650 Original CRISPR CTCTGGCTAATAAGGTAAAG TGG Intergenic
No off target data available for this crispr