ID: 978735289

View in Genome Browser
Species Human (GRCh38)
Location 4:112077603-112077625
Sequence GTAGGGCTCCACCACTGTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978735289_978735293 18 Left 978735289 4:112077603-112077625 CCGACACAGTGGTGGAGCCCTAC 0: 1
1: 0
2: 0
3: 7
4: 100
Right 978735293 4:112077644-112077666 TACCAGCTCATAGAAAATGCAGG 0: 1
1: 0
2: 3
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978735289 Original CRISPR GTAGGGCTCCACCACTGTGT CGG (reversed) Intergenic