ID: 978735356

View in Genome Browser
Species Human (GRCh38)
Location 4:112077992-112078014
Sequence CCTGCAAGGCTGCTACCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978735347_978735356 24 Left 978735347 4:112077945-112077967 CCCAGCAGACGTTTGATGCCAAG 0: 1
1: 2
2: 14
3: 8
4: 100
Right 978735356 4:112077992-112078014 CCTGCAAGGCTGCTACCTAATGG 0: 1
1: 0
2: 1
3: 13
4: 131
978735348_978735356 23 Left 978735348 4:112077946-112077968 CCAGCAGACGTTTGATGCCAAGA 0: 1
1: 1
2: 16
3: 10
4: 71
Right 978735356 4:112077992-112078014 CCTGCAAGGCTGCTACCTAATGG 0: 1
1: 0
2: 1
3: 13
4: 131
978735350_978735356 6 Left 978735350 4:112077963-112077985 CCAAGACTATGATGACTGCCGGT 0: 1
1: 0
2: 0
3: 1
4: 56
Right 978735356 4:112077992-112078014 CCTGCAAGGCTGCTACCTAATGG 0: 1
1: 0
2: 1
3: 13
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978735356 Original CRISPR CCTGCAAGGCTGCTACCTAA TGG Intergenic
900083117 1:873929-873951 CCGTCACGGCCGCTACCTAACGG + Intergenic
900112407 1:1013977-1013999 CCTGCAGGGCTGGGACCTGACGG + Exonic
903385244 1:22921785-22921807 TCTGCAAGGCAGCTAACAAATGG - Intergenic
903672853 1:25046722-25046744 TTTTCAAGGCTGCTACCAAAGGG + Intergenic
904357939 1:29953496-29953518 CAGTCAAGGCTGCTACCTGATGG - Intergenic
908933601 1:69346283-69346305 CCTGCGTGAATGCTACCTAAAGG + Intergenic
910110374 1:83676232-83676254 ACTGCATGGCTGCCACCCAATGG + Intergenic
923142290 1:231170877-231170899 CCAACAAGGCTGCAATCTAAAGG - Intronic
923298926 1:232622605-232622627 CATGAAAGGCGGCCACCTAAGGG + Intergenic
924243304 1:242059867-242059889 CCGTCATGGCTGCTACCTAATGG + Intergenic
1062763941 10:47455-47477 CCGTCACGGCCGCTACCTAACGG - Exonic
1064924139 10:20551350-20551372 ACTGCAAGGATGTTAACTAATGG - Intergenic
1067657930 10:48211355-48211377 CCTGCAGGGCTGCAAACTTAGGG + Intronic
1071066721 10:81644690-81644712 CCTGCAAGGCTGCAGCCTGGCGG - Intergenic
1074201552 10:111240684-111240706 CCTGCAAGGCAGCTTCCTAGAGG + Intergenic
1074355435 10:112778674-112778696 CCTGGAGGACTGCTACCTGATGG - Intronic
1074455877 10:113594785-113594807 CCTGCAAGGCAGCCACCTCTGGG + Intronic
1084549068 11:69830176-69830198 CCTGCTAGCCTGCTACATAATGG - Intergenic
1086334587 11:85787246-85787268 TCTGCAAGGCTGCTATGTGAAGG + Intronic
1087346742 11:96981497-96981519 GCTGCAAGGGTCCTACCCAAAGG - Intergenic
1088098837 11:106131648-106131670 CCAGCAATGCTGCTGCCAAATGG + Intergenic
1094482324 12:30894771-30894793 CCTGCAAGGCTGCAGCCTGGCGG - Intergenic
1094782757 12:33811744-33811766 CCTCCAGGGCTGCTATCCAAAGG - Intergenic
1099410092 12:82314585-82314607 CCTGCAAGGCTGCAGCCTGGCGG - Intronic
1100838283 12:98587849-98587871 CTTGCAAGACAACTACCTAAGGG + Intergenic
1101804385 12:108050834-108050856 CCTCCAAGGCTGATAACAAATGG + Intergenic
1104720477 12:131042605-131042627 GCAGCAAGGCTGCTACCTGGTGG - Intronic
1106853128 13:33817097-33817119 CCTGGAAGGCTTCTGCCTCAGGG - Intergenic
1107894918 13:44951990-44952012 AATGCGAGGCTGATACCTAAGGG - Intronic
1108269962 13:48749882-48749904 CCGGCTCGGCTGCCACCTAATGG - Intergenic
1109816227 13:67588738-67588760 CCTGCAAGGCTGCAGCCTGGTGG + Intergenic
1111931648 13:94518902-94518924 CCAGCAAGACTGCAACTTAAAGG - Intergenic
1113913258 13:113854728-113854750 CCCGCAAGGATGCTGCCAAATGG - Intronic
1114080199 14:19197245-19197267 CTTGGAAGCCTGCTACCTGAAGG - Intergenic
1121532220 14:94663020-94663042 CCTGAAAGCTTGCTACATAAAGG + Intergenic
1123496053 15:20828156-20828178 CCTGAATGGCTGCCACCTGATGG - Intergenic
1123552538 15:21397248-21397270 CCTGAATGGCTGCCACCTGATGG - Intergenic
1123553066 15:21400453-21400475 CCTGCATGGCTGCATCCTGATGG - Intergenic
1123588784 15:21834636-21834658 CCTGAATGGCTGCCACCTGATGG - Intergenic
1123589311 15:21837841-21837863 CCTGCATGGCTGCATCCTGATGG - Intergenic
1126074502 15:44896259-44896281 CCTGCAAGGCTGCAGCCTGGTGG - Intergenic
1126108223 15:45160984-45161006 CCTGCCAGGCTGGTACCTGAGGG - Exonic
1130515156 15:84620828-84620850 CCTGCAGGGCACCTACCTAGGGG + Exonic
1131120043 15:89816451-89816473 GAAGCAAGGCTGCTACCTAGAGG - Intergenic
1202960887 15_KI270727v1_random:124468-124490 CCTGAATGGCTGCCACCTGATGG - Intergenic
1202961414 15_KI270727v1_random:127673-127695 CCTGCATGGCTGCATCCTGATGG - Intergenic
1133148830 16:3811090-3811112 CTTCCAAAGCTGCTACCCAAGGG + Intronic
1138427892 16:56948439-56948461 CCCGCAAGACAGCTACCTCAGGG - Intergenic
1139893513 16:70269789-70269811 CCAGAAAGTCTGCTTCCTAAAGG - Intronic
1142440707 16:90095772-90095794 CCGTCATGGCCGCTACCTAACGG + Intergenic
1146145491 17:30412601-30412623 CCTGCGAGGCTGCAGCCTCATGG - Intronic
1149170458 17:53803898-53803920 TCTCTAAGGCTACTACCTAAAGG - Intergenic
1150813910 17:68377958-68377980 CCTGAAAGGCTGCTGCCTGGGGG + Intronic
1152354478 17:79800093-79800115 CCTGCAACGCTGCTCTCTCACGG - Intronic
1152956848 18:47788-47810 CCGTCACGGCTGCTACCTAACGG - Exonic
1154453455 18:14500648-14500670 CCTGAATGGCTGCCACCTGATGG - Intergenic
1156471753 18:37381479-37381501 CCTGCAAGGCTCCCACCTCAAGG - Intronic
1157818805 18:50750602-50750624 CCTGCAAGGCAGATACCCAGAGG + Intergenic
1161663999 19:5564057-5564079 CCTGCAACGCTGCTGCCTCGAGG + Intergenic
925339612 2:3127066-3127088 CCTGCCCGGCTGCTGCCTCAGGG - Intergenic
930582186 2:53225642-53225664 ACTGCAATGATGGTACCTAAAGG + Intergenic
930969899 2:57382506-57382528 CCTGCAAGGCGGCCACCTGCAGG - Intergenic
932073665 2:68644249-68644271 CCTACAAGCATGCTACCTGAAGG - Intronic
932377557 2:71251146-71251168 CCTGCAAGGCTGCAGCCTGGCGG - Intergenic
934099044 2:88634165-88634187 CCTGCAAAGATACTACCTGAGGG - Intergenic
935218311 2:100991551-100991573 CCTGCGAGGCTTCTACATGAGGG - Intronic
936111866 2:109671322-109671344 CCTACAAGGCTCCTACCACATGG - Intergenic
937607412 2:123818166-123818188 TCTCTAAGGCTGCTACCTAGAGG - Intergenic
940389862 2:153119712-153119734 CAGGCAAGGCTGCTCCCAAAGGG - Intergenic
942605073 2:177682069-177682091 TCTGGAAGGCTGCTACCTGGAGG + Intronic
943198334 2:184785103-184785125 CCTGCAAGGTTGCTATCTTAGGG + Intronic
944280915 2:197895798-197895820 CCTTCAAGGCTTCTAACTCAAGG - Intronic
945308331 2:208281627-208281649 CTTGCAAGGCAGCTAACTCAGGG + Intronic
948756961 2:240165590-240165612 CCCTCAAGGCTGCTTCCTTACGG - Intergenic
1169212623 20:3776052-3776074 CCTACAAGGCTGCAAGCAAAGGG - Intergenic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1175958007 20:62621258-62621280 CCTGCCAGGCTGCGACCCCAGGG - Intergenic
1176820729 21:13652657-13652679 CCTGAATGGCTGCCACCTGATGG + Intergenic
1180500575 22:15925439-15925461 CTTGGAAGCCTGCTACCTGAAGG + Intergenic
952645912 3:35658713-35658735 CCTAAAAGGCAGCTACTTAAAGG - Intronic
953217180 3:40930512-40930534 ACTGCATGGCTGCTACCAGAGGG - Intergenic
954440000 3:50516589-50516611 CAGGTAAGGATGCTACCTAAGGG + Intergenic
960890526 3:122443224-122443246 CCTGCAAGGCTGCAGCCTGGCGG + Intronic
960939091 3:122922057-122922079 CCTCCACGGCTGCTACCTGGAGG - Exonic
967423374 3:189298376-189298398 AGTGCAAGACTGTTACCTAAAGG - Intronic
968357464 3:198120359-198120381 CCGTCACGGCCGCTACCTAATGG + Intergenic
972138545 4:35925307-35925329 CCTCACAGGCTGCTACCTGAAGG - Intergenic
976007759 4:80450976-80450998 GCTGGATGGCTGCTACCTACAGG - Intronic
978494020 4:109339999-109340021 CCAGCCAGGCTGCTGCCTCACGG - Intergenic
978735356 4:112077992-112078014 CCTGCAAGGCTGCTACCTAATGG + Intergenic
979661369 4:123259420-123259442 CCTCAGAGGCTGCTCCCTAACGG - Intronic
979707275 4:123735581-123735603 CCTGCAAGACTCTTAGCTAAGGG - Intergenic
980290068 4:130836916-130836938 GCTGAAATGCTGCTACCTCAAGG - Intergenic
980980870 4:139653703-139653725 TCTGCAATCCTGCCACCTAAGGG + Intergenic
985441075 4:189982891-189982913 CCGTCACGGCCGCTACCTAACGG - Intergenic
988491765 5:31711210-31711232 CCAGCAAGGCTCATTCCTAATGG + Intronic
993075504 5:83225548-83225570 CCTCCATAGCTCCTACCTAAGGG - Intronic
997214420 5:132098592-132098614 CCTGGAAGGATGCTACCCAAGGG - Intergenic
997498290 5:134349755-134349777 CCAGCAATGCAGGTACCTAAAGG + Intronic
1001705558 5:173738779-173738801 CTTGCAAGTCTGCTTCCCAAGGG - Intergenic
1003806294 6:9729016-9729038 CCTGCAAGAGTGCTACCCACTGG + Intronic
1004740052 6:18450825-18450847 CCTGCAAAGTTGCTACCTCAGGG + Intronic
1007856319 6:44862008-44862030 CCTGCAAGGACACTACCTTAAGG + Intronic
1010820670 6:80411687-80411709 CCTGCGAGGCTGCAGCCTGATGG - Intergenic
1011028208 6:82892696-82892718 CCTGGAAGGTTATTACCTAATGG - Exonic
1013921910 6:115415695-115415717 CCTGCAAAGCTGCCTCTTAAGGG - Intergenic
1016178243 6:141107739-141107761 CCTGCATGGCTGTTGCCAAAGGG + Intergenic
1018208637 6:161459256-161459278 CCTGCCAGTCTGCAACCTAAAGG + Intronic
1019256782 7:57410-57432 TCTCCAAGGCTGCTGCCTATGGG - Intergenic
1021136431 7:16970528-16970550 AATGCATGACTGCTACCTAATGG - Intergenic
1021203846 7:17755503-17755525 TCTGCAAGGTTATTACCTAATGG + Intergenic
1027253471 7:76414452-76414474 CATGCCAGGCTGCTCCCAAAGGG - Intronic
1031794478 7:126154240-126154262 ACTGTAAGGCTGCTATGTAACGG - Intergenic
1034235036 7:149560034-149560056 GCTGCAAGGCTGCTGGCTGAGGG - Intergenic
1034720515 7:153288074-153288096 CCTGCAACCCTGCCACCAAATGG + Intergenic
1035056146 7:156038227-156038249 GCTACCAGGCTGCTACATAAGGG - Intergenic
1035972100 8:4260156-4260178 CTTGCAAGGATGCCACCTGATGG - Intronic
1037039695 8:14216108-14216130 CCTGCAAGGCTACTCTCTCAGGG - Intronic
1039124821 8:34189637-34189659 CCTGCATCCCTGCAACCTAAAGG + Intergenic
1040045999 8:42964304-42964326 CCTGCAATGCTGCAACCTGTTGG - Exonic
1040560192 8:48517057-48517079 CCTGCAGGGCTGCTCACTGACGG + Intergenic
1046689910 8:117270984-117271006 CCTGCTAGGCTGCTACCCAAAGG + Intergenic
1046880911 8:119307179-119307201 CCTGCAAGGCTGAAGCCTACTGG + Intergenic
1047141190 8:122141550-122141572 CCTGTAAAGGTGCTAACTAAGGG - Intergenic
1049486941 8:142870368-142870390 CTTGCAAGGCAGCTCCCTCAGGG + Intronic
1050387006 9:5101303-5101325 CCTGCCAGGCTGCTGCCTCACGG - Intronic
1059887591 9:118763917-118763939 CTGCCATGGCTGCTACCTAATGG + Intergenic
1060241508 9:121907682-121907704 CTTGGAAGGTTGCTACCAAATGG - Intronic
1062741316 9:138176844-138176866 CCGTCACGGCCGCTACCTAACGG + Intergenic
1203526627 Un_GL000213v1:96908-96930 CCTGAATGGCTGCCACCTGATGG - Intergenic
1203526948 Un_GL000213v1:98825-98847 CCTGCATGGCTGCGTCCTGATGG - Intergenic
1186679238 X:11854609-11854631 CCTGCAAGTCTGAAATCTAATGG + Intergenic
1187812295 X:23192664-23192686 CCTGAAGGGCTGCTACAAAAAGG + Intergenic
1188830740 X:34893944-34893966 CCTGCAAGTCTGCCACCTTGTGG - Intergenic
1190106478 X:47564700-47564722 CCTCCAAGCCTGCTACCCACAGG - Intronic
1190879239 X:54481130-54481152 CCTGCAAGGCTTCTACTCAAGGG - Intronic
1192188777 X:68978161-68978183 CCCACAAGGCTACTGCCTAAGGG + Intergenic
1194087799 X:89550703-89550725 CTTGCAAGGCAGTTACCTTAGGG - Intergenic
1195729268 X:107949273-107949295 CCTGCCAGGCTGCTGCCTCACGG + Intergenic
1197959636 X:131989873-131989895 CCTGCAAGGCTGCAGCCTGGTGG + Intergenic
1198505303 X:137295279-137295301 CATGCAAGTCTGCCACATAAAGG + Intergenic
1200371391 X:155728533-155728555 CCTGCAAGGCTGCAGCCTGGAGG - Intergenic
1200440823 Y:3210100-3210122 CTTGCAAGGCAGTTACCTTAGGG + Intergenic
1201758869 Y:17517230-17517252 CTGTCATGGCTGCTACCTAATGG - Intergenic
1201842686 Y:18388760-18388782 CTGTCATGGCTGCTACCTAATGG + Intergenic
1201938703 Y:19435303-19435325 CCTGCAAGGCTGCAGCCTGGTGG + Intergenic