ID: 978738926

View in Genome Browser
Species Human (GRCh38)
Location 4:112115593-112115615
Sequence TACCTTGGCCTCCCAAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4672
Summary {0: 2, 1: 30, 2: 239, 3: 1298, 4: 3103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978738919_978738926 25 Left 978738919 4:112115545-112115567 CCATGTTGGCCAGGCTAGTCTCG 0: 1974
1: 48807
2: 158508
3: 217371
4: 143480
Right 978738926 4:112115593-112115615 TACCTTGGCCTCCCAAAGGCTGG 0: 2
1: 30
2: 239
3: 1298
4: 3103
978738920_978738926 16 Left 978738920 4:112115554-112115576 CCAGGCTAGTCTCGAACACCTGG 0: 9
1: 823
2: 17746
3: 122944
4: 221961
Right 978738926 4:112115593-112115615 TACCTTGGCCTCCCAAAGGCTGG 0: 2
1: 30
2: 239
3: 1298
4: 3103
978738922_978738926 -2 Left 978738922 4:112115572-112115594 CCTGGCCTCAAATGATCTGTTTA No data
Right 978738926 4:112115593-112115615 TACCTTGGCCTCCCAAAGGCTGG 0: 2
1: 30
2: 239
3: 1298
4: 3103
978738923_978738926 -7 Left 978738923 4:112115577-112115599 CCTCAAATGATCTGTTTACCTTG No data
Right 978738926 4:112115593-112115615 TACCTTGGCCTCCCAAAGGCTGG 0: 2
1: 30
2: 239
3: 1298
4: 3103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978738926 Original CRISPR TACCTTGGCCTCCCAAAGGC TGG Intergenic
Too many off-targets to display for this crispr