ID: 978744479

View in Genome Browser
Species Human (GRCh38)
Location 4:112176096-112176118
Sequence CAATTTGTGCACGTTAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978744479 Original CRISPR CAATTTGTGCACGTTAATAT TGG (reversed) Intronic
909923982 1:81416568-81416590 CAAAATGTGAACGTTAAAATAGG - Intronic
911540231 1:99148735-99148757 CAATTTGTGCCTGTTATTATTGG - Intergenic
916844237 1:168632070-168632092 CAATTAGTGGAGGTCAATATAGG + Intergenic
923998077 1:239519416-239519438 CAAATTTTGCAAGTTAATCTTGG - Intronic
1067071386 10:43135169-43135191 CAATGTGTACAAGTTGATATGGG + Intergenic
1067809241 10:49414480-49414502 CTTTTTGTGCACGTTGCTATTGG - Intergenic
1074688581 10:115981910-115981932 CAATTTGTGCATGAGAATAATGG + Intergenic
1077753316 11:4998783-4998805 GAATTTGTGCTCCTTAATATTGG + Intergenic
1078084695 11:8226767-8226789 AAATGTGTGCACTTTAATATTGG - Intronic
1079700720 11:23542542-23542564 CAAGTTGTCCACTTTAATTTGGG - Intergenic
1080676151 11:34429425-34429447 CAATTTATGAAATTTAATATGGG - Intergenic
1092333652 12:7608592-7608614 CTCTGTGTGCACGTTAACATGGG - Intergenic
1098486248 12:71025251-71025273 CAATGTGTGTAAGTTACTATAGG + Intergenic
1100141326 12:91622219-91622241 AAATTTGTGCAGGGTAATAAAGG + Intergenic
1103468517 12:121161338-121161360 AAAATTCTGCAGGTTAATATGGG - Intronic
1108199971 13:48033140-48033162 CAATTTGTACAAGAAAATATAGG - Intergenic
1108909826 13:55533900-55533922 CAATTATTGCAACTTAATATGGG - Intergenic
1108988084 13:56619593-56619615 CATTTAGTGCATTTTAATATTGG + Intergenic
1109073202 13:57796173-57796195 CAATTTGTTCAGATGAATATTGG + Intergenic
1109435907 13:62302344-62302366 CAATTTATGCAAGTGAAGATAGG - Intergenic
1113277923 13:108753788-108753810 TACTTTGTGCAAGTTAATGTAGG - Intronic
1116328908 14:43571025-43571047 CTATTTGTTCACTTAAATATTGG - Intergenic
1117084392 14:52184362-52184384 CAATTTGGGCACATTTGTATGGG - Intergenic
1118084043 14:62395327-62395349 GAATTTGTGAACTTTAAGATAGG - Intergenic
1120168393 14:81224374-81224396 AAATTTGTGCATGTGAAAATCGG - Intergenic
1130827303 15:87562615-87562637 CAATGTGTTCATGTTAATCTTGG - Intergenic
1139296224 16:65903515-65903537 AAATTTGAGCAGGCTAATATTGG + Intergenic
1144611042 17:16715910-16715932 CAAGTGGCGCACGTTGATATTGG + Intronic
1150431931 17:65125312-65125334 GAATTTTTGCACATGAATATTGG - Intergenic
1153811260 18:8753911-8753933 CAATTTGTGACTGTTAATATGGG + Intronic
1156106697 18:33672061-33672083 AAATTTGTGAATGATAATATTGG + Intronic
1156160782 18:34355466-34355488 CAATTAGTGCACTTTAATCTTGG - Intergenic
1157014137 18:43689555-43689577 CAATATGTTCATGTTATTATTGG + Intergenic
930178761 2:48329299-48329321 GAATCTGTGCAAGTTAGTATAGG + Intronic
931649757 2:64456689-64456711 CAATTTGGACATGTAAATATGGG - Intronic
934507878 2:94909360-94909382 CAAACTGTGCACTTTAAAATAGG - Intergenic
936414081 2:112288545-112288567 TAATTTGTTCATGTTCATATAGG + Intronic
936687449 2:114844539-114844561 CAACTTGTGTACTTGAATATTGG - Intronic
939577289 2:143911646-143911668 CAATTTGTCCACATTTATAGAGG - Intergenic
940637406 2:156315798-156315820 GAATTTGTGCACCTGAATCTTGG - Intergenic
945441994 2:209890596-209890618 CAAGTTGTGCATCTTAAAATGGG + Intronic
1169475142 20:5924170-5924192 CAATTTCTCCCCGTGAATATCGG - Intronic
1173557432 20:43976079-43976101 AAATTTGTTCACATTAAGATTGG - Intronic
1178120879 21:29468795-29468817 CCATTTCTGCATGTTAACATAGG + Intronic
1180622995 22:17174331-17174353 CAATTTATGCATATTAAAATGGG - Intergenic
949769636 3:7565615-7565637 CAAATTGTGCACAGTTATATGGG + Intronic
955761667 3:62291353-62291375 GAATTTGTGCACTTTAGCATAGG - Intronic
956189410 3:66594539-66594561 AAATTTGTGCATTTTATTATAGG + Intergenic
956284353 3:67593048-67593070 CAATTTGTGTACATTACTATAGG + Intronic
958109187 3:89117161-89117183 CATTTTGAGAAGGTTAATATAGG + Intronic
960062087 3:113333634-113333656 TAATTTGTCTACTTTAATATAGG + Intronic
962794095 3:138835683-138835705 CTATTTGTCCAGGGTAATATAGG - Intergenic
963382699 3:144552121-144552143 CAATTTTTTCACCTTATTATTGG + Intergenic
974118894 4:57613923-57613945 CAGTTTCTGCATCTTAATATGGG + Intergenic
975054121 4:69906465-69906487 CAATTTGTCCACAGTAAGATAGG - Intergenic
977018832 4:91733222-91733244 GAATTAGTGAACTTTAATATAGG + Intergenic
978744479 4:112176096-112176118 CAATTTGTGCACGTTAATATTGG - Intronic
979771258 4:124527319-124527341 TTATTTGTGCAAGTTAATTTTGG - Intergenic
981214982 4:142153949-142153971 CCCTTTGTGGACCTTAATATTGG + Intronic
984266310 4:177501262-177501284 CGATTTGTGTACATTAATCTTGG + Intergenic
984301856 4:177929940-177929962 CAATTTGTTCTCGTTTATGTGGG - Intronic
988212353 5:28220902-28220924 CTATTTGTGTACGTAAATAGTGG + Intergenic
993210015 5:84937150-84937172 CCATTTGTGTACCTAAATATAGG - Intergenic
997586748 5:135048000-135048022 CAGTTTGTTCACTGTAATATGGG + Intronic
999409462 5:151338291-151338313 CAATTTGAGCAAAATAATATGGG - Intronic
1011522802 6:88227961-88227983 TAATTTGTGCACTTTTCTATAGG - Intergenic
1013271462 6:108549470-108549492 CAATTGTTGTACATTAATATTGG - Intergenic
1014486397 6:122004172-122004194 CAATTTTAGCAAGTAAATATTGG + Intergenic
1019874370 7:3796190-3796212 GAATTTGTGTAGGTTAATAAAGG + Intronic
1021701907 7:23327740-23327762 CAATTTGTGCCATTTAATGTCGG + Intronic
1024719376 7:52118124-52118146 CAATTTTTTCAGGTTAATTTTGG - Intergenic
1037210222 8:16377082-16377104 CAATGTTTGCATTTTAATATTGG + Intronic
1037464478 8:19146577-19146599 CAATTTGAGCATGATATTATTGG - Intergenic
1046403920 8:113747368-113747390 CAAAATGTAGACGTTAATATAGG - Intergenic
1046531751 8:115455150-115455172 CAATATGTGCCTGTTAAGATAGG - Intronic
1046824828 8:118676387-118676409 CATTTTGTACCAGTTAATATTGG + Intergenic
1047991103 8:130287764-130287786 CTATTTGTGCCCTTTAACATAGG + Intronic
1050758790 9:9040454-9040476 CAAATTCTGCACATTTATATTGG + Intronic
1054353215 9:64038061-64038083 CAAACTGTGCACTTTAAAATAGG + Intergenic
1056980589 9:91307196-91307218 CAAATTGTACACTTTAATATGGG + Intronic
1058210515 9:102161862-102161884 CAATTTGTGTATGTGAAAATAGG + Intergenic
1059265295 9:113023182-113023204 CTATTTGAGCACGTTTATAATGG + Intergenic
1203741548 Un_GL000218v1:7173-7195 CAAACTGTGCACTTTAAAATAGG + Intergenic
1185908170 X:3957270-3957292 CATTTTGTGAGCTTTAATATGGG + Intergenic
1186652952 X:11580774-11580796 CCATTTGTGGAAGTGAATATAGG + Intronic
1187535763 X:20140742-20140764 AAAATTGTGCAAGTAAATATAGG - Intronic
1192701175 X:73475814-73475836 CATTTTGTGCCCATTAATATAGG - Intergenic
1193856815 X:86612512-86612534 CAATTTTTGAATGTTAAAATGGG + Intronic
1194774548 X:97945863-97945885 CAATTCCTGCATTTTAATATTGG - Intergenic
1198419494 X:136455997-136456019 CATTTTGTGGACGAAAATATGGG - Intergenic
1199397295 X:147353922-147353944 CAATTTTTGCACATTGATTTTGG - Intergenic
1201155079 Y:11124626-11124648 CAAACTGTGCACTTTAAAATAGG + Intergenic