ID: 978749368

View in Genome Browser
Species Human (GRCh38)
Location 4:112230253-112230275
Sequence GTTTTGTAACATGTCACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978749368_978749370 28 Left 978749368 4:112230253-112230275 CCAGTGGTGACATGTTACAAAAC No data
Right 978749370 4:112230304-112230326 CATTAATATAGACAAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978749368 Original CRISPR GTTTTGTAACATGTCACCAC TGG (reversed) Intergenic
No off target data available for this crispr