ID: 978749370

View in Genome Browser
Species Human (GRCh38)
Location 4:112230304-112230326
Sequence CATTAATATAGACAAGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978749367_978749370 29 Left 978749367 4:112230252-112230274 CCCAGTGGTGACATGTTACAAAA 0: 1
1: 2
2: 20
3: 97
4: 476
Right 978749370 4:112230304-112230326 CATTAATATAGACAAGATGCAGG No data
978749366_978749370 30 Left 978749366 4:112230251-112230273 CCCCAGTGGTGACATGTTACAAA No data
Right 978749370 4:112230304-112230326 CATTAATATAGACAAGATGCAGG No data
978749368_978749370 28 Left 978749368 4:112230253-112230275 CCAGTGGTGACATGTTACAAAAC No data
Right 978749370 4:112230304-112230326 CATTAATATAGACAAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978749370 Original CRISPR CATTAATATAGACAAGATGC AGG Intergenic
No off target data available for this crispr