ID: 978752402

View in Genome Browser
Species Human (GRCh38)
Location 4:112265294-112265316
Sequence CTATTGTATCACATCTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978752402_978752405 -8 Left 978752402 4:112265294-112265316 CCCATATAGATGTGATACAATAG 0: 1
1: 0
2: 1
3: 9
4: 90
Right 978752405 4:112265309-112265331 TACAATAGCTGAATGCCTTTGGG 0: 1
1: 0
2: 0
3: 16
4: 147
978752402_978752404 -9 Left 978752402 4:112265294-112265316 CCCATATAGATGTGATACAATAG 0: 1
1: 0
2: 1
3: 9
4: 90
Right 978752404 4:112265308-112265330 ATACAATAGCTGAATGCCTTTGG 0: 1
1: 0
2: 0
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978752402 Original CRISPR CTATTGTATCACATCTATAT GGG (reversed) Intronic
903150897 1:21407862-21407884 TTATTGTATCATATATTTATGGG + Intergenic
909275513 1:73680716-73680738 CTATTGTGGCACATTTAGATAGG - Intergenic
909963823 1:81882026-81882048 CTTTTGTAGTACATCTATCTTGG - Intronic
910185343 1:84532713-84532735 CTATTGACTTATATCTATATAGG + Intergenic
911435328 1:97848654-97848676 CTATTGCATCACACTTATAAAGG + Intronic
916629455 1:166595813-166595835 CTATTTTATCACATGCTTATTGG + Intergenic
918075850 1:181170913-181170935 CTATTGTCTCACAGCTCTAGAGG - Intergenic
918525876 1:185464460-185464482 CTTTTGTATCACATTTTTATTGG + Intergenic
919505137 1:198388843-198388865 CTATTGCAGCACATCTATTCTGG + Intergenic
924012562 1:239681590-239681612 CTAATTTATAACATCTTTATTGG - Intronic
924221943 1:241886204-241886226 CTAATTTATCACATCTAAAATGG + Intronic
1065162873 10:22941357-22941379 GCATTGTATTACATCTAAATTGG + Intronic
1068908623 10:62354559-62354581 CTATTTTATCCTTTCTATATTGG + Intergenic
1071091889 10:81928683-81928705 CTATTCAATCACTTCTCTATTGG - Intronic
1077781324 11:5332763-5332785 TTATTATATCACATTTCTATAGG - Intronic
1084055844 11:66632261-66632283 CTACTGTACCACATCAATTTTGG + Intronic
1085063355 11:73469426-73469448 CTCTTGTATCACTTCAAAATAGG + Intronic
1091265480 11:134267879-134267901 CTAATTTATCAAATCTATAAAGG - Intergenic
1095826822 12:46538501-46538523 CCATTTTATCACATCTATATTGG + Intergenic
1098972612 12:76872071-76872093 CTATTTTATCACATGTAAAGTGG - Intronic
1101145737 12:101839006-101839028 TTATTGCATCCCATCAATATTGG + Intergenic
1101765336 12:107693187-107693209 CTATTGTATCTCATTTAAGTTGG + Intronic
1105671406 13:22620549-22620571 CTATTGTAGAACATCTATAAAGG - Intergenic
1108726308 13:53185369-53185391 ATATTGAATAACATCTGTATTGG - Intergenic
1109163620 13:59006865-59006887 ATATTGTATAAAATCTATAAAGG + Intergenic
1110221106 13:73074852-73074874 CCATTGTATCACAAGTATTTGGG + Intronic
1110582402 13:77146017-77146039 TTATTATATGACATCTCTATCGG + Intronic
1110689019 13:78410007-78410029 CTATTTTATAACATCTAGAGGGG - Intergenic
1116010720 14:39348437-39348459 CTATTGTATCAAATATATACTGG - Intronic
1116416162 14:44679964-44679986 CTATTTTATAAAATCTACATTGG - Intergenic
1120418794 14:84255535-84255557 TTATTGTTTCACATCTCTACGGG - Intergenic
1125150550 15:36526493-36526515 CCTTTCTCTCACATCTATATAGG - Intergenic
1127378499 15:58407175-58407197 CTGTTTTATGACATCTATTTGGG + Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1127946615 15:63761631-63761653 TAATTGTATTACATCTATATAGG - Intronic
1129307681 15:74679381-74679403 CTAATATATCACATATATTTAGG + Intronic
1131406445 15:92168846-92168868 CTACAGTGTCACAGCTATATGGG - Intronic
1131884437 15:96896727-96896749 CTTTTATATCACATTTATATAGG + Intergenic
1143049900 17:4116426-4116448 CTATGTTCTCACATGTATATCGG + Intronic
1150963985 17:69946941-69946963 CTATTTTATAACATCTATCTAGG + Intergenic
1153463786 18:5366363-5366385 CTAATGGATCACAGATATATAGG + Intergenic
1157001678 18:43534366-43534388 ATATTTTTTCACATCTAAATAGG - Intergenic
925042347 2:741507-741529 CACTTGTATCACATCAATATGGG - Intergenic
925570611 2:5308496-5308518 CTATTATATCAAATCTTAATGGG + Intergenic
935745925 2:106190279-106190301 AGATTATACCACATCTATATAGG + Intronic
939706956 2:145467039-145467061 CTATAGAATAACATCTACATAGG + Intergenic
942589772 2:177529806-177529828 CTATGGAATCAAATCTATATTGG + Intronic
943562490 2:189480592-189480614 ATATTCTATCATTTCTATATTGG - Intergenic
945825471 2:214716246-214716268 CTATTTAAGCACACCTATATAGG - Intergenic
947531741 2:230913272-230913294 CTATTGTTTCTCATCACTATTGG + Intronic
1169580013 20:7010906-7010928 ATATTGTATCACTTCTTTCTGGG + Intergenic
1171785057 20:29456273-29456295 CCATTTTATCACATCCAAATTGG + Intergenic
1175110316 20:56643449-56643471 CTTTTGGATAACATCTAGATGGG + Intergenic
1176905189 21:14491832-14491854 GTTTTTTATCATATCTATATAGG - Intronic
953943134 3:47120013-47120035 CTATACTATCAAATCTAAATAGG + Intronic
959123191 3:102257505-102257527 CTGTTGTATCTTATCTATGTAGG + Intronic
965076077 3:163978078-163978100 CTAATGAATCACATCTGCATAGG + Intergenic
965746798 3:171934743-171934765 CTTTTGAATCACATTTTTATTGG + Intronic
966141315 3:176759688-176759710 CTAGTGTGTAACATCAATATGGG + Intergenic
966892852 3:184419682-184419704 CCATTGTTTCTCATCTATTTTGG - Intronic
978752402 4:112265294-112265316 CTATTGTATCACATCTATATGGG - Intronic
980478540 4:133354253-133354275 CTATTTTATCACAAATATGTAGG + Intergenic
982546973 4:156746096-156746118 CTATTTTATCCCATCTAAATTGG + Intergenic
982597204 4:157401777-157401799 CTCTTGTAACACCTCTATAGAGG - Intergenic
982698119 4:158627636-158627658 CTATTGTATCGCCTATATACAGG - Intronic
984284374 4:177710172-177710194 TTATTGTAGCACCTCTATACAGG - Intergenic
984784620 4:183555987-183556009 CTCTTGTATCAAATCAATTTTGG + Intergenic
985832687 5:2246397-2246419 ATATCCTATCACATATATATAGG + Intergenic
987216275 5:15740716-15740738 CTGTTGTATCATATGTATTTTGG - Intronic
989621909 5:43393089-43393111 CTATTGTCTCAGAACTATAGTGG + Intronic
989961184 5:50417262-50417284 CCATTGTATCATTTTTATATAGG - Intronic
990695934 5:58417108-58417130 CTATGCTATTACATCTATACAGG + Intergenic
992449002 5:76858740-76858762 CTTTTGTATCATCTCTCTATAGG - Intronic
994510122 5:100692091-100692113 CTCTTGTATTACATATAAATGGG + Intergenic
995949205 5:117689354-117689376 CTTTTCTATTACATATATATTGG + Intergenic
1004824059 6:19401391-19401413 CTCTTATATCATTTCTATATGGG - Intergenic
1009488907 6:64262082-64262104 CAATTTTATCTCATCTAAATGGG - Intronic
1012049984 6:94329016-94329038 CTATTGTATCACAGCTGAGTGGG - Intergenic
1012130384 6:95483647-95483669 CAATTGTATTACGTCTAAATTGG + Intergenic
1012943909 6:105446290-105446312 CTTCTGTATAACATCCATATAGG - Intergenic
1013885529 6:114960596-114960618 CTATTGCATCAAATCTCTAGAGG + Intergenic
1018350406 6:162952660-162952682 AAATTGTATCACATCTTTAAAGG + Intronic
1018885894 6:167936860-167936882 TATTTGTATCACATCAATATGGG - Intronic
1021514745 7:21471867-21471889 ATATTGTTTCACATCCCTATGGG - Intronic
1028909048 7:96187466-96187488 CTATTGATTTCCATCTATATAGG - Intronic
1033898537 7:146106460-146106482 CTATTGTATGAAATCAATAGTGG - Intergenic
1037784275 8:21893269-21893291 CTTTTGTTTCACATCAAGATGGG - Intergenic
1039287027 8:36052859-36052881 CTATTAAATCAAATCTCTATAGG - Intergenic
1040977486 8:53210171-53210193 CTATTATGACACATGTATATTGG - Intergenic
1042319136 8:67456735-67456757 TTAATGTATCACATCTACAGAGG - Intronic
1043715181 8:83474915-83474937 ATATTGTAACACATCGATACTGG + Intergenic
1050575885 9:6994786-6994808 ATAATTTATCACATTTATATTGG - Intronic
1059207506 9:112480556-112480578 ATATTGTATTACTTATATATTGG + Intronic
1186641034 X:11455832-11455854 CTATTTTCTCACTTCTATAATGG + Intronic
1187124325 X:16439570-16439592 CTATTTTCACACATCTCTATAGG - Intergenic
1188193458 X:27199261-27199283 CTATTATATAACCTTTATATTGG + Intergenic
1189540387 X:41981431-41981453 CTCTTGCATCCCTTCTATATGGG - Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1194456756 X:94114284-94114306 CTAATATATCACATCTATTCTGG + Intergenic
1194688302 X:96951893-96951915 CTATTAGATCACATTTATTTTGG - Intronic
1194701770 X:97122307-97122329 CTATTTTATTACAAATATATAGG - Intronic