ID: 978754881

View in Genome Browser
Species Human (GRCh38)
Location 4:112291171-112291193
Sequence CTTCGTAGGCAGCTCCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978754881_978754890 23 Left 978754881 4:112291171-112291193 CCATGCAGGAGCTGCCTACGAAG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 978754890 4:112291217-112291239 TGGCATCTAGGAGCTGAGAGTGG 0: 1
1: 6
2: 31
3: 92
4: 446
978754881_978754888 11 Left 978754881 4:112291171-112291193 CCATGCAGGAGCTGCCTACGAAG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 978754888 4:112291205-112291227 AGGAAATTCCAGTGGCATCTAGG 0: 1
1: 0
2: 1
3: 18
4: 222
978754881_978754885 -9 Left 978754881 4:112291171-112291193 CCATGCAGGAGCTGCCTACGAAG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 978754885 4:112291185-112291207 CCTACGAAGGCCACATGGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 109
978754881_978754887 3 Left 978754881 4:112291171-112291193 CCATGCAGGAGCTGCCTACGAAG 0: 1
1: 0
2: 1
3: 9
4: 102
Right 978754887 4:112291197-112291219 ACATGGCAAGGAAATTCCAGTGG 0: 1
1: 0
2: 2
3: 20
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978754881 Original CRISPR CTTCGTAGGCAGCTCCTGCA TGG (reversed) Intronic
900567635 1:3341427-3341449 CTTCCTAAGCAGCTCCTGAATGG + Intronic
900600595 1:3501180-3501202 CTTCGTCGGCAGCCGCTGCCAGG - Exonic
901701274 1:11045848-11045870 CTCCTTAGGAAGCTGCTGCAAGG - Intronic
901954553 1:12774947-12774969 CTCCCTGGGCAGCTCCTCCAGGG - Exonic
901961339 1:12828682-12828704 TTCCGTGGGCAGCTCCTCCAGGG + Exonic
901972280 1:12917772-12917794 CTCCCTGGGCAGCTCCTCCATGG - Exonic
901989087 1:13097870-13097892 CTCCCTGGGCAGCTCCTCCAGGG + Intergenic
901992726 1:13128897-13128919 CTCCCTGGGCAGCTCCTCCAGGG - Intergenic
902012899 1:13283990-13284012 CTCCCTGGGCAGCTCCTCCATGG + Exonic
902030158 1:13416434-13416456 TTCCGTGGGCAGCTCCTCCAGGG - Exonic
902478165 1:16698862-16698884 CTTCCTAGCCAGTTCCTGCCAGG - Intergenic
902690851 1:18109466-18109488 CTAGGTAGGCACCTCCTGCTGGG - Intronic
903886918 1:26546076-26546098 CTTCCCAGGCACCTGCTGCAAGG - Intronic
904375903 1:30082386-30082408 CTTTGAAGGCAGCTCCTGGACGG + Intergenic
906116260 1:43359169-43359191 CTCCGTAGGCACCAACTGCAAGG + Exonic
914410316 1:147421123-147421145 CGCCGTAGGCAGCTCCTGGAAGG - Intergenic
914456391 1:147841041-147841063 CTCCTTGGGCAGCTCCTCCAGGG - Intergenic
921820440 1:219610647-219610669 CTTCATGTGCACCTCCTGCATGG + Intergenic
1062881338 10:980548-980570 AACCGTTGGCAGCTCCTGCATGG - Intergenic
1063369912 10:5514486-5514508 CTGAGAAGGCAGCTCTTGCACGG + Intergenic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1067246438 10:44550536-44550558 CTTGCTAGGCTGCTCCTTCATGG + Intergenic
1072606276 10:96985558-96985580 GTTCGTGGGCAGATGCTGCAGGG - Exonic
1072641661 10:97215696-97215718 CTCCCTAAGCAGTTCCTGCAGGG + Intronic
1075068924 10:119308104-119308126 CTTTGTAGGCCGAACCTGCAGGG + Intronic
1077870378 11:6257813-6257835 CTGCTTAGGCAACTCCTGAAGGG + Intergenic
1080934403 11:36847205-36847227 CTTTGTAGCCAGCTCATGAAGGG - Intergenic
1083801198 11:65047498-65047520 CTTCCTGGGCATCTCCTCCATGG - Exonic
1085808314 11:79657276-79657298 CTCCCCAGGCAGCTCCAGCATGG - Intergenic
1088590534 11:111399141-111399163 CTTCAAGGGCACCTCCTGCATGG - Intronic
1089778584 11:120856952-120856974 CCTTGTGGGCAGCTTCTGCAAGG - Intronic
1090171940 11:124613032-124613054 CTACGTGGACAGCTCCTGCTGGG + Exonic
1091168436 11:133500633-133500655 CTCCCATGGCAGCTCCTGCACGG + Intronic
1091253194 11:134161347-134161369 CTCCGAAGGCAGCTCCTGCAGGG + Intronic
1096680795 12:53253910-53253932 CTCCGTAGGAAGCTCATGCTGGG - Exonic
1101506166 12:105348603-105348625 CATCTTTGGCTGCTCCTGCAGGG - Exonic
1103930230 12:124446239-124446261 CTACCTCGGCAGCTCCTGCAGGG + Intronic
1106146370 13:27053300-27053322 CTTCCCAGGCAGCTCCTGGAAGG + Intergenic
1106408314 13:29493365-29493387 CTTCCCAGGCAGCTCTTCCATGG - Intronic
1117492790 14:56268881-56268903 CTTTGTAGGGAGCTGCTACACGG + Intronic
1120633053 14:86914723-86914745 CTTTGTAGGCAGCTTTTGTAAGG - Intronic
1121514987 14:94543623-94543645 CTGCTGAGTCAGCTCCTGCAGGG + Intergenic
1122152261 14:99731571-99731593 CTTCTTGGGCAGCCCCTGCGGGG + Intergenic
1124725368 15:32151920-32151942 AGTCATGGGCAGCTCCTGCAGGG + Intronic
1128807012 15:70538681-70538703 CTTTGTGGTCAGCCCCTGCAGGG + Intergenic
1130625178 15:85506974-85506996 CTTCCTAGTCAGCTCTTACATGG + Intronic
1131081880 15:89543470-89543492 CTTCGAAGGCAGCTGTGGCAGGG - Intergenic
1133056567 16:3148316-3148338 TCTTGCAGGCAGCTCCTGCAGGG + Exonic
1138424031 16:56918517-56918539 CTTCGCAGACAGCTACTACATGG - Intergenic
1142501521 17:335796-335818 CTTCGCAGGTGGCGCCTGCAGGG + Intronic
1143724040 17:8833165-8833187 CTTCGGGGGAAGCTCCTGCCGGG - Intronic
1143909668 17:10237381-10237403 CATGGTAGGCAGCTTCTGAAAGG - Intergenic
1150124142 17:62625994-62626016 CCTCTGAGGCAGCTCCAGCATGG + Intergenic
1151199235 17:72455646-72455668 CTTGGGAGGCAGATGCTGCAAGG - Intergenic
1151568968 17:74916528-74916550 CTTGGGAAGCAGCTCCTGCTGGG - Exonic
1152390701 17:80002126-80002148 CTTCCGTGGGAGCTCCTGCAAGG + Intronic
1152538706 17:80964158-80964180 ATCCTTAGGCAGCTCCTGCCGGG - Intronic
1153605062 18:6824852-6824874 CTCCGTAGACAGCGCCTCCATGG + Intronic
1160044188 18:75371533-75371555 CTTCTTAGGTTGTTCCTGCAAGG + Intergenic
1160944551 19:1635313-1635335 CTTGGAAGGAAGCTGCTGCAGGG - Intronic
1161723880 19:5917639-5917661 CTTCGTCACCAGCACCTGCAGGG + Exonic
1167577174 19:50323279-50323301 CTTCTTGGGCAGCTTCTGCTTGG + Exonic
1202712186 1_KI270714v1_random:24690-24712 CTTCCTAGCCAGTTCCTGCCAGG - Intergenic
926348932 2:11977800-11977822 CTGCGGAGTAAGCTCCTGCATGG - Intergenic
928428489 2:31199034-31199056 CTTTGTAGGCAGGTCCTGCCTGG + Intronic
931695713 2:64869162-64869184 CTTCGTACGTGGGTCCTGCAGGG + Intergenic
938422498 2:131155935-131155957 CTTGGGAGGCAGCGCCTGCTGGG + Intronic
938753165 2:134354714-134354736 CTTCCTAAGCAGCTTCTGGAGGG + Intronic
942885395 2:180917247-180917269 CTTCCTAGGAAGCTCTTTCATGG + Intergenic
942939227 2:181597643-181597665 CTGGGTGGCCAGCTCCTGCAGGG + Intronic
948300731 2:236904897-236904919 CTTCTTAGGCTGCTCCCTCAGGG - Intergenic
948585350 2:239015642-239015664 CTTCCCAGCCAGCTCCTGCAGGG - Intergenic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1171396189 20:24835327-24835349 CTTCCTGGGCTGCTCCTGGAGGG - Intergenic
1177740734 21:25149547-25149569 ATTCCTAGGCAGCAGCTGCATGG - Intergenic
1177874100 21:26610027-26610049 CTTCCTCAGCAGGTCCTGCAGGG + Intergenic
1178301028 21:31453301-31453323 CTTCATAGGCAGTTCCAACATGG - Intronic
1178788017 21:35672500-35672522 CATGGTAGTTAGCTCCTGCAAGG - Intronic
1178998628 21:37431634-37431656 CTTGGTGGGAAGCTACTGCAAGG - Intronic
1182351372 22:29701900-29701922 CTTCGCAGGCAGCTCCAGCCCGG - Intergenic
1182767888 22:32771915-32771937 TTTCTTAGGCAGCTGCTGCTTGG + Intronic
1183938335 22:41277613-41277635 CTTCTTAGGGAGCCCCTGCTAGG - Intronic
1184666121 22:45990013-45990035 CTCCCTAGGCGGCCCCTGCAGGG - Intergenic
1184797540 22:46740732-46740754 CTTCGCAGCCAGCTCCTGAAGGG - Intergenic
1185068381 22:48643262-48643284 TTACGCAGGAAGCTCCTGCAAGG + Intronic
1185269353 22:49921814-49921836 CTAGGCAGGCAGCTCCAGCAAGG - Intronic
953759833 3:45677886-45677908 CTTGGAAGGCCGCTTCTGCAAGG + Exonic
954540538 3:51390793-51390815 CCTCGTTGGCATCTCCTGCCTGG - Intergenic
961448866 3:126993431-126993453 CTTTGTGGGCAGCTGCTGGATGG + Intronic
978754881 4:112291171-112291193 CTTCGTAGGCAGCTCCTGCATGG - Intronic
984623105 4:181975644-181975666 CTGGTTAGGCAGCTACTGCAGGG + Intergenic
988853189 5:35199045-35199067 CTTGGCAGGAAGCTCTTGCAGGG + Intronic
998027139 5:138827684-138827706 CTCCGAAAGCAGGTCCTGCAGGG - Exonic
1001562007 5:172675978-172676000 CTTCCTAGGCAGCTCCAGGGTGG + Intronic
1002847554 6:961550-961572 CTCCATAGGCAGCTCCTCCCAGG - Intergenic
1006451751 6:34109423-34109445 CTCCAGAGGCAGCCCCTGCAGGG - Intronic
1007469124 6:42076919-42076941 CTTCATAGCCAGCCCCTGCCTGG + Intronic
1009565198 6:65303915-65303937 CTTCATGTGCACCTCCTGCATGG - Intronic
1010958361 6:82117346-82117368 CTATGTAGGCAGCTATTGCAAGG + Intergenic
1013932989 6:115557243-115557265 CTGAGTAAGCAGCTCCTGTATGG - Intergenic
1020598832 7:10247629-10247651 CTGACTAGGCAGTTCCTGCAAGG + Intergenic
1024959230 7:54957470-54957492 CTTCACAGTCAGCTCTTGCATGG + Intergenic
1026994410 7:74606311-74606333 CTTCATAGGCAGTTTCTGCTTGG - Intergenic
1032080749 7:128857302-128857324 CATCGTGGGCAGCCCCTTCAAGG + Exonic
1032091505 7:128913858-128913880 CATCGTGGGCAGCCCCTTCAAGG - Intergenic
1033258354 7:139821080-139821102 CTTCATAGGCAGGACCAGCAGGG + Intronic
1036692195 8:10951117-10951139 CTTCCTGGGCACCTGCTGCAAGG - Intronic
1041165482 8:55088455-55088477 CTTCAAAGGGAGCTCCTGCTGGG + Intergenic
1051875308 9:21786903-21786925 CTTCTTTGGCAGCTCCTTTAAGG - Intergenic
1057220351 9:93254326-93254348 CCTCGTGAGCAGCTCCTGCCTGG + Intronic
1061328904 9:129880105-129880127 GCCCGTAGTCAGCTCCTGCAGGG - Exonic
1189270302 X:39746815-39746837 CTTCCTAGGCAGCTCTTCCTGGG - Intergenic
1194951001 X:100125790-100125812 CTTCATAGGCAGATACTGAAAGG + Intergenic