ID: 978758557

View in Genome Browser
Species Human (GRCh38)
Location 4:112330455-112330477
Sequence TATGCACTACCACCCAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 87}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978758557 Original CRISPR TATGCACTACCACCCAAAGA GGG Intronic
901040642 1:6361051-6361073 TATTCACAACCACCCAAGGATGG + Intronic
901304142 1:8220364-8220386 CATCCACTTCCACCCACAGACGG - Intergenic
906134566 1:43488045-43488067 TATGCTCTTCCACCCAAAAAAGG + Intergenic
907887930 1:58610840-58610862 TAGGCACTTCCACCCAAAGCAGG - Intergenic
908573275 1:65432307-65432329 CATGGACTACAACACAAAGAGGG - Exonic
909785697 1:79609743-79609765 TATGCAATATAACTCAAAGAAGG - Intergenic
915695043 1:157731891-157731913 TATGTACTATCTCCCAAGGATGG + Intergenic
918875690 1:190039762-190039784 TATATACTACAAACCAAAGAGGG - Intergenic
1062861224 10:811929-811951 TATCCTCCACCAGCCAAAGAGGG + Exonic
1064417518 10:15163358-15163380 TTTGCACTAACAAACAAAGATGG + Intronic
1069945039 10:71979621-71979643 TCTGCATTTCCACCCAGAGATGG + Intronic
1074005923 10:109423121-109423143 TATCCACTATGACCCAAACAGGG + Intergenic
1078937779 11:15966612-15966634 TATACATTATCACCCAAAGATGG + Exonic
1088113857 11:106294604-106294626 TATGCACTAAGACCCAATGTGGG - Intergenic
1090088112 11:123669111-123669133 TATTCACTACCACCCTAGGATGG - Intergenic
1090181354 11:124702906-124702928 TATGAACTACAACCCTAAGAGGG + Intergenic
1096354204 12:50926400-50926422 TATCAGATACCACCCAAAGAGGG - Intronic
1099292729 12:80791600-80791622 TATGAAATACAACTCAAAGAAGG - Intergenic
1099848370 12:88058628-88058650 CATGCCCTGCCACCCAAACAAGG + Intronic
1101964416 12:109272714-109272736 TATTCACAACCACCAAAAGGTGG - Intergenic
1106283587 13:28299197-28299219 TATGCACTACCACCCGGATCAGG + Intergenic
1106352957 13:28952002-28952024 GGTGCACTTCCACACAAAGATGG - Intronic
1109112631 13:58341737-58341759 TAAACACACCCACCCAAAGAAGG - Intergenic
1110556162 13:76861693-76861715 TATACACTGCCACCAAGAGAAGG + Intergenic
1113734279 13:112666296-112666318 TATGCACTCCCACACACACACGG - Intronic
1114351332 14:21854904-21854926 TCTGCAGTACCACGCAAAAATGG - Intergenic
1115380945 14:32738331-32738353 TATTCATTACCAGCTAAAGAAGG + Intronic
1122330152 14:100906495-100906517 CATGCACTACATCCCAAAAAGGG + Intergenic
1130042520 15:80417271-80417293 TATGCACCAGCAACCAAAAACGG - Intronic
1131506379 15:93023439-93023461 TATTCACAACAGCCCAAAGATGG - Intronic
1133116390 16:3580145-3580167 TATGCACTGCCACCCAGCCAGGG - Intergenic
1140934513 16:79658057-79658079 TATGCACCACCACCCACCAAGGG - Intergenic
1142826312 17:2513544-2513566 AAGCCACTACCAACCAAAGATGG - Intergenic
1146452427 17:32985425-32985447 GATTCACCACCACCCTAAGAGGG + Intronic
1155303288 18:24453820-24453842 TATTTAATACCAGCCAAAGATGG + Intergenic
1157169287 18:45387330-45387352 TATGCCCTGCCCCCCAAACAAGG + Intronic
1157346947 18:46846816-46846838 TATGCACCACCGCCTAAAAATGG - Exonic
1160109584 18:76013418-76013440 GATGCATTACTAACCAAAGAAGG - Intergenic
1161170179 19:2808566-2808588 CATCCAATGCCACCCAAAGATGG + Intronic
925097804 2:1221032-1221054 GATGCAGTTCCACCCAGAGAAGG - Intronic
925242696 2:2346346-2346368 GAGGCCCCACCACCCAAAGATGG - Intergenic
931523602 2:63127750-63127772 TTTTTACTATCACCCAAAGAGGG - Intronic
933870509 2:86561154-86561176 TTTATACTACCTCCCAAAGAGGG - Intronic
941502496 2:166297328-166297350 TATGCATTATAACCAAAAGACGG + Intronic
942919502 2:181354359-181354381 TATTCATAACCACCCTAAGAGGG - Intergenic
945459520 2:210089118-210089140 AGTTCAATACCACCCAAAGAAGG + Intronic
948114758 2:235486523-235486545 TCTGCACTACCTCCCAGAAATGG + Intergenic
1172023676 20:31933837-31933859 TCCCGACTACCACCCAAAGAAGG + Exonic
1172455393 20:35068142-35068164 TTTGCACTACCACCCAAATTAGG - Intronic
1174622506 20:51886785-51886807 AACCCACTACCACACAAAGAAGG - Intergenic
1181030228 22:20145951-20145973 TATCCACCACCACCCAGAGCAGG - Intronic
1184883543 22:47327811-47327833 TATTCACTATAACCCAAAGATGG + Intergenic
950510531 3:13423189-13423211 TAAACACTGACACCCAAAGAAGG - Intergenic
959110431 3:102116179-102116201 CATGCACTGCCTTCCAAAGATGG + Intronic
963253813 3:143124359-143124381 TAGGCACTACCACAAAAATATGG - Intergenic
967698815 3:192567668-192567690 TATGCACCACAAGCCAAGGAAGG - Intronic
970813482 4:20125071-20125093 TCTTCTCTACCACTCAAAGAGGG + Intergenic
972589086 4:40467225-40467247 TATCCACTACCAACCAGAGTTGG + Intronic
972687157 4:41361931-41361953 TCTGAACTACCAGGCAAAGAGGG - Intronic
975429275 4:74269293-74269315 TATACACTAACGCACAAAGAAGG - Intronic
975901163 4:79154958-79154980 TAGACACTACCACTCAATGAAGG + Intergenic
977925456 4:102695520-102695542 TAGTCATTACCACCCAATGAGGG - Intronic
978758557 4:112330455-112330477 TATGCACTACCACCCAAAGAGGG + Intronic
986510837 5:8504807-8504829 AACTCACTGCCACCCAAAGAAGG - Intergenic
986822036 5:11477980-11478002 TAAACTCTACCACCCAAAGCTGG - Intronic
987173933 5:15287423-15287445 TCTGCACCACCGCCCACAGAAGG - Intergenic
987869518 5:23596728-23596750 TATGCCCTACCATCCATAGTAGG + Intergenic
994301236 5:98150429-98150451 TTTGCAATAACACCCAAAAATGG - Intergenic
995564419 5:113418930-113418952 AAGGCACAACCAACCAAAGAGGG + Intronic
998163901 5:139829757-139829779 TATTCACAATCACCAAAAGATGG - Intronic
1001074484 5:168615301-168615323 GATGGTCTACCACCCAAAGTCGG + Intergenic
1002372343 5:178765315-178765337 TATTCACAACCACCAAAAGGTGG - Intergenic
1006684930 6:35824772-35824794 TATGCACCACCCCCCAGGGAGGG - Intronic
1008625057 6:53307244-53307266 TAACCACTACCACCCAAAAGTGG - Intronic
1014432140 6:121383491-121383513 TGTGCACTCCCAGCCAAAGATGG + Intergenic
1015145606 6:129982399-129982421 TTTGGACCACCACTCAAAGAAGG - Intergenic
1015145624 6:129982738-129982760 TTTGGACCACCACTCAAAGAAGG + Intergenic
1015378856 6:132543976-132543998 TATCCACTACCAACCTAAAAGGG - Intergenic
1020575892 7:9927447-9927469 TATTCACTGCCACCCCAAGATGG - Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1028748214 7:94351875-94351897 TATGCACTGCCACCCATACAAGG + Intergenic
1031402013 7:121336519-121336541 TATGCACTACAACACGATGAAGG - Intronic
1032607515 7:133371657-133371679 TATGCGCAACAACCCAAAGGTGG - Intronic
1033213408 7:139477291-139477313 TATTCACAACAACCCAAACATGG + Intronic
1033575440 7:142678878-142678900 TATGCACAAACACACATAGAAGG + Intergenic
1040555882 8:48477231-48477253 TGAGCACTACCACCCACAAATGG - Intergenic
1045906532 8:107352760-107352782 TATGCACCAACATCCAATGAAGG - Intronic
1049765035 8:144351205-144351227 TATGCACTAAGACCCAGGGAGGG - Intergenic
1051618878 9:19032309-19032331 ACTGCGCTTCCACCCAAAGATGG + Intronic
1056728639 9:89144366-89144388 TATGCACTGGCACCCCAGGACGG + Intronic
1056924912 9:90826157-90826179 TTTGCACTGCCACCTGAAGATGG + Intronic
1056961258 9:91126125-91126147 TTTGCCCTGCCACCCAAAGAGGG + Intergenic
1057264963 9:93610710-93610732 TATACACTACCATCCAGAGGAGG + Intronic
1189042684 X:37559056-37559078 TATTATCTACCACTCAAAGAAGG - Intronic
1191122455 X:56920745-56920767 TATGCCCTACCCCCCAGAGGTGG + Intergenic
1191147424 X:57182585-57182607 TTTGCACTCCCACCAACAGAGGG - Intergenic
1192036971 X:67574171-67574193 TATGCGACACCACCCATAGAGGG + Intronic
1195912834 X:109905863-109905885 TGAGCAGTACCATCCAAAGAAGG + Intergenic
1197504678 X:127287053-127287075 TATGCAGTACCACCTGAAGGTGG - Intergenic
1201649641 Y:16271241-16271263 CATGCACTACCACGCATTGAAGG - Intergenic