ID: 978758747

View in Genome Browser
Species Human (GRCh38)
Location 4:112332217-112332239
Sequence TGGTTTATCAATAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978758743_978758747 -5 Left 978758743 4:112332199-112332221 CCTTAAATATAAAGCCTATGGTT 0: 1
1: 0
2: 0
3: 19
4: 179
Right 978758747 4:112332217-112332239 TGGTTTATCAATAAGGAGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 177
978758741_978758747 -1 Left 978758741 4:112332195-112332217 CCTTCCTTAAATATAAAGCCTAT 0: 1
1: 0
2: 1
3: 24
4: 273
Right 978758747 4:112332217-112332239 TGGTTTATCAATAAGGAGGAAGG 0: 1
1: 0
2: 0
3: 25
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978758747 Original CRISPR TGGTTTATCAATAAGGAGGA AGG Intronic
900829244 1:4952804-4952826 TAGTTTAGCAACAAGGAGAAAGG + Intergenic
902778797 1:18691566-18691588 TTGTTTATCAATGTGAAGGATGG - Intronic
905885585 1:41490077-41490099 TTGTTTCTCATGAAGGAGGATGG - Intergenic
906444566 1:45884190-45884212 TACTTTATCAAAAAAGAGGAGGG - Intronic
908907488 1:69033070-69033092 TGGTTTATAAAAAAGTAGAAGGG - Intergenic
908926364 1:69259892-69259914 TAGTTTATCAGTAATGAGTATGG - Intergenic
909911000 1:81257745-81257767 TGTTTTAGCAATAGGGGGGATGG + Intergenic
910780665 1:90928617-90928639 TGTTTTAAAAATAAGGAGGCCGG - Intronic
911271698 1:95809506-95809528 TGGTTTTTCCACAGGGAGGAAGG + Intergenic
911793788 1:102051976-102051998 TTATTTATCAATAAAGAGGTGGG + Intergenic
912953906 1:114139444-114139466 TGGGTGATCAATGAGGAGGTGGG - Intronic
915529543 1:156495462-156495484 TGGGTTCTCAAAAGGGAGGAAGG - Intronic
919353604 1:196492881-196492903 TGGTTGATCCATAAGTAGGAAGG - Intronic
920100075 1:203511783-203511805 CTGTTTACCAATAAGCAGGAAGG - Intergenic
920931411 1:210392518-210392540 TGCTTTATGCATAAGGAGTAAGG + Intronic
1064763842 10:18651124-18651146 GGCTTTATGAATAAGGAGGTAGG - Exonic
1064818866 10:19300684-19300706 TGGTTTTTGAATATGGAGTAAGG - Intronic
1066336655 10:34484942-34484964 TGGGTTGCCAATGAGGAGGAAGG - Intronic
1066489901 10:35884318-35884340 TGGTTTGACAATAATGGGGAAGG - Intergenic
1067157664 10:43795615-43795637 TGGTTTAACAAGAAGGAGCAGGG + Intergenic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1069182381 10:65377831-65377853 TGGTTTCCAAATAAGGAGCATGG + Intergenic
1070219710 10:74427563-74427585 TGGTTTCTCACTATGGAAGAAGG + Intronic
1072369324 10:94747773-94747795 TAGTTCATCAAAAGGGAGGAGGG + Intronic
1073004357 10:100311074-100311096 TGGTTTTTATATAAGGAGCATGG - Intronic
1076602664 10:131668929-131668951 TGATTTATCAGTGAGGAGAAAGG - Intergenic
1079094910 11:17503958-17503980 TGGGTTATCAGTGAGGAGGCTGG + Intronic
1083422224 11:62560475-62560497 GGGTCAATCAATAAGGAGGAAGG + Intronic
1086410403 11:86539117-86539139 GGGGTTGTTAATAAGGAGGAAGG + Intronic
1088128317 11:106456368-106456390 TAGTTTATAAATTAAGAGGAAGG + Intergenic
1089182976 11:116595637-116595659 TGGGAAATCAATAAGGAGGCGGG + Intergenic
1092069643 12:5622302-5622324 TGATTTATCAGTATGGAGGAAGG - Intronic
1092233903 12:6793568-6793590 AGGTTTCTGAAAAAGGAGGAAGG - Intronic
1092772269 12:11908388-11908410 TGTTTTATCAATATGAGGGAAGG - Intergenic
1092926485 12:13276914-13276936 TGTATCATCCATAAGGAGGAAGG - Intergenic
1094505523 12:31057678-31057700 TGGTTTTTTAAAAAGGAAGAAGG - Intergenic
1095690985 12:45088186-45088208 TGTTTATTCACTAAGGAGGAAGG + Intergenic
1095907573 12:47393570-47393592 TTGTTTTTCAATAACAAGGATGG - Intergenic
1096739443 12:53681653-53681675 TGGTTTTTTAAAAAGGAGGAGGG - Intergenic
1097991466 12:65839358-65839380 TCGTTTCTCAAGAAGGATGAGGG + Intronic
1100338255 12:93653725-93653747 TGGTTTTTCGTTGAGGAGGAGGG + Intergenic
1100902882 12:99263195-99263217 TGATTTAACAGTAAGGAGCATGG - Intronic
1101057268 12:100931071-100931093 TGGTTTACCAATAAGAAAAAAGG - Intronic
1102363617 12:112311739-112311761 TAGTTTCTCACTGAGGAGGATGG - Intronic
1106600814 13:31185022-31185044 TGCTTGATCAATAACTAGGAAGG - Intergenic
1106966559 13:35078059-35078081 TGCTTTATAAATAAAGGGGAAGG + Intronic
1107741730 13:43457462-43457484 CAATTTATCAATAAGAAGGAAGG + Intronic
1108421073 13:50250170-50250192 AGGATAATCAATAATGAGGAAGG - Intronic
1109928735 13:69184165-69184187 CAGTTTATCAATCAGGAGAAGGG - Intergenic
1110856245 13:80300042-80300064 TGGGTTATTCATAAGGAGGATGG + Intergenic
1111116366 13:83783250-83783272 TGATATAGCAATAATGAGGATGG + Intergenic
1112485020 13:99811895-99811917 TGCTTTATCAATAAGAAGGGTGG - Intronic
1114938662 14:27577087-27577109 TGGTTTATGAATTAGGGTGATGG - Intergenic
1117439335 14:55745442-55745464 TGGGGTGTCAATGAGGAGGAAGG + Intergenic
1118899458 14:69974312-69974334 AGGTGTATCACAAAGGAGGAGGG + Intronic
1119574433 14:75705988-75706010 TGGTTAAACAATGAGGAGGGAGG - Intronic
1120117749 14:80640276-80640298 TGTTTTAGCAATAATGATGATGG - Intronic
1120210017 14:81624668-81624690 TGGATTTTGAAAAAGGAGGAGGG - Intergenic
1125492148 15:40156309-40156331 TTGTTTACCACTGAGGAGGAAGG + Intergenic
1127993787 15:64140300-64140322 TTGTTTATCAATATGGATGCAGG + Intronic
1139919005 16:70447134-70447156 TTGTTTAACAATAAGGAGTTTGG + Intergenic
1141365826 16:83441946-83441968 GGCTTTATCTATAAGGAGGCTGG + Intronic
1148988558 17:51645703-51645725 TGCTTTCTCCCTAAGGAGGAAGG - Intronic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1154280646 18:12999682-12999704 TGTTTTATCTATGAGGGGGATGG + Intronic
1155244603 18:23895111-23895133 TGGATTCTCCATAAGCAGGAAGG + Intronic
1155608681 18:27637385-27637407 TTGTTTTTGAATAAGAAGGAGGG - Intergenic
1157581847 18:48778314-48778336 TCATTTATCAATCAGGAGGCGGG + Intronic
1158886747 18:61835487-61835509 AGGTTCATGAATAAGGAGGCAGG + Intronic
1159623579 18:70667453-70667475 TCTTTTAACAATAAGGAGGAAGG - Intergenic
1160301969 18:77690193-77690215 TGGTGTCTGAATAAGGAGAACGG - Intergenic
1162569029 19:11460225-11460247 TGGATTCTGGATAAGGAGGAAGG - Intronic
1165251561 19:34540671-34540693 TGGTTTGTAAGTAGGGAGGATGG - Intergenic
1166838397 19:45681628-45681650 TGCTTCATCAACAAGGAGGTAGG + Exonic
925197305 2:1936741-1936763 TGGCTAATCAATATGGAGAATGG + Intronic
926339877 2:11896133-11896155 TGGTGTAGGAAGAAGGAGGATGG + Intergenic
926548811 2:14275791-14275813 TTGTTTATAAATAAGCTGGAGGG + Intergenic
927308908 2:21605935-21605957 TGGTTTATAAATAAGGAAATTGG + Intergenic
927449687 2:23197995-23198017 TTGTTAAACACTAAGGAGGAAGG + Intergenic
927864218 2:26578380-26578402 TGTTTTATCAGTAAGGATGATGG - Intronic
930247370 2:48998259-48998281 TGGTATATTAATGAGGAGGAAGG + Intronic
931672005 2:64655236-64655258 TGTTTTATCTTTAAGGAGGATGG + Intronic
933534128 2:83551404-83551426 TGATTCTTCAATAAGGAAGAGGG - Intergenic
934468996 2:94497994-94498016 TGGTTTTTGAATAAGGTGTAAGG - Intergenic
935313506 2:101808135-101808157 TATTTTATCCATTAGGAGGATGG + Intronic
936918554 2:117664424-117664446 TGGTCTATGCAAAAGGAGGAAGG - Intergenic
941289389 2:163656701-163656723 TGTTTCATCAATAAGGAAGCAGG + Intronic
941535774 2:166721134-166721156 TGGTGTAGGAAAAAGGAGGAGGG - Intergenic
944560465 2:200931447-200931469 TGCTTTAAAAAAAAGGAGGAGGG + Exonic
944678134 2:202051508-202051530 TGCCTTATCAAAAAGGAGTAAGG + Intergenic
945194582 2:207226412-207226434 AGCATTATCAACAAGGAGGAAGG + Intergenic
947504509 2:230696840-230696862 TGGTTTTTCTATGAGGAGTAGGG + Intergenic
1171409367 20:24935746-24935768 TGGTTTCTCACTAAGGACTAAGG - Intergenic
1173931699 20:46826299-46826321 TGATTTATCAAAGTGGAGGAGGG - Intergenic
1178557985 21:33610552-33610574 TTATTTATAAATCAGGAGGATGG - Intronic
1183991157 22:41597837-41597859 TGGTTTATAAAGATGGGGGAAGG - Intergenic
949189557 3:1235776-1235798 TGCTTTCTCAATAGGGAGGCTGG + Intronic
949235131 3:1799548-1799570 TAGCTTATCAATATGAAGGATGG + Intergenic
951437200 3:22678371-22678393 TGGGTTATCAACATAGAGGAAGG - Intergenic
952496995 3:33924697-33924719 TGGTTTCTAGAAAAGGAGGAAGG - Intergenic
953120948 3:40041082-40041104 TTGTTTATCAATATGGATGCAGG - Intronic
955162839 3:56481753-56481775 CGGTTTATTAATAAGGAATATGG + Intergenic
955877197 3:63504466-63504488 TGGTTTGTAAATTTGGAGGAGGG - Intronic
956357372 3:68408964-68408986 TGCTTTTCCTATAAGGAGGAAGG - Intronic
956665216 3:71636081-71636103 TCGTTTATGAATAAGATGGACGG + Intergenic
957539977 3:81555340-81555362 TGGTTTACCTATATGGAGGGTGG - Intronic
957889038 3:86331019-86331041 TGGTTAATAGATAAGGAGGATGG + Intergenic
960194197 3:114745310-114745332 TGGGTTATCAATAAGTATTAAGG - Intronic
961817094 3:129556684-129556706 TGGTATTTCTATAAGGAGGCAGG + Exonic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
965041661 3:163516868-163516890 GGCATTATCAAGAAGGAGGAAGG + Intergenic
965056166 3:163719423-163719445 TGGTTTTTCACTAAGGAATAAGG + Intergenic
966339239 3:178906565-178906587 TGGTTTTTCAGTAAGGAAGACGG + Intergenic
966508429 3:180733478-180733500 AGTTTTATTAATAAGGAAGAAGG - Intronic
966510238 3:180754058-180754080 TGGTTGGTCAATAATTAGGAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968723412 4:2225184-2225206 TGGGTTAACAATAAGGGAGAGGG + Intronic
968979264 4:3837808-3837830 TGTTTTATAGATAAGGAGGGTGG - Intergenic
970166686 4:13245528-13245550 GGGTTTATCTGTAAGGGGGAAGG + Intergenic
970340737 4:15103912-15103934 TTGTTTTTGATTAAGGAGGAAGG + Intergenic
970471633 4:16385040-16385062 TGGTTAATCAAGAACAAGGAGGG - Intergenic
971855549 4:32038889-32038911 TTATTTATCAAAAAGGAAGAAGG + Intergenic
972916385 4:43885054-43885076 TGTTTTGTCAATTAGAAGGAGGG - Intergenic
975664221 4:76718940-76718962 GGGTTTCTCATTAAGGAGGAAGG + Intronic
975925557 4:79447026-79447048 TGATTTATCAATAAGGTGAAAGG - Intergenic
978682700 4:111401369-111401391 TATTTTAGCAATAAAGAGGATGG - Intergenic
978758747 4:112332217-112332239 TGGTTTATCAATAAGGAGGAAGG + Intronic
980599776 4:135007202-135007224 TAGTTTAACAATATTGAGGATGG - Intergenic
980847794 4:138344716-138344738 TGGTTGATCAATGAGGGGGAAGG + Intergenic
981038161 4:140193753-140193775 AGTTTTATCAATAAGTTGGATGG + Intergenic
982377400 4:154708481-154708503 GGTTTTATGAATAAGAAGGATGG - Intronic
984379522 4:178972861-178972883 TTTTCTATCCATAAGGAGGAAGG - Intergenic
986751422 5:10791350-10791372 TAGTTTATCAATAACTAGGAAGG - Intergenic
987684750 5:21182657-21182679 TGGATTACCAATAAAGAGCATGG - Intergenic
988459395 5:31419165-31419187 TTGTGTTTCAAGAAGGAGGAGGG + Intronic
988848254 5:35152145-35152167 TGGTTTATAGTTAAGGAGAATGG - Intronic
989859862 5:46357310-46357332 TGCTCTATCAATCAGAAGGAAGG + Intergenic
990995183 5:61726147-61726169 TGATTTATGAATGTGGAGGAAGG + Intronic
991955924 5:71996040-71996062 TGTTTTATCAATAAGGAAATGGG + Intergenic
994009152 5:94879463-94879485 ATGATTATCAATTAGGAGGAGGG - Intronic
994674926 5:102808919-102808941 TGGATTATCCTTAAGAAGGATGG - Intronic
995424722 5:112007695-112007717 TTGTTTTTTAATAAAGAGGAAGG + Intergenic
996311826 5:122114961-122114983 TGCTTTATAAATTGGGAGGAAGG - Intergenic
996699600 5:126437070-126437092 TGGTTTATCTATAAGGCACAGGG + Intronic
1000232663 5:159330637-159330659 GTGTGTATCAATAACGAGGAGGG + Exonic
1003964543 6:11240455-11240477 TGGTTTATCAAGAACTAAGAGGG - Intronic
1004157877 6:13186428-13186450 CGATTTAGCAATAAGGAAGATGG - Intronic
1004792855 6:19047454-19047476 TGATTTAAAAATTAGGAGGAAGG - Intergenic
1008328667 6:50218810-50218832 TGGTTTATCCATAAGCTTGACGG - Intergenic
1010316135 6:74452542-74452564 TTATTTATCAATAAGGAGACAGG - Intergenic
1010921270 6:81683666-81683688 TGGTTTAGCAATAAACAGGCAGG - Intronic
1014261249 6:119220491-119220513 TGGATTACCAATAAGTATGAAGG - Intronic
1014540683 6:122672052-122672074 TTGTCCATCAAAAAGGAGGATGG + Intronic
1016134401 6:140521089-140521111 TACTTTATAAATAAGGATGAAGG - Intergenic
1016234645 6:141848687-141848709 TGTTTTCTCACTGAGGAGGAGGG - Intergenic
1016686677 6:146889842-146889864 TCATTTACCATTAAGGAGGAAGG - Intergenic
1016792265 6:148078376-148078398 AGGTTTATCAATATGGATGCTGG + Intergenic
1018382890 6:163275805-163275827 TGAATTATTAATAAGGAGGCAGG - Intronic
1019465697 7:1187317-1187339 CTGTTTAGCAAGAAGGAGGAAGG + Intergenic
1020464920 7:8466616-8466638 TAGTATATCATTAAGGAAGATGG + Intronic
1020932941 7:14422730-14422752 TGGTTCATTAACAAGGTGGAAGG + Intronic
1020941248 7:14541018-14541040 TGGTCTATCAAGAAGGAGTCTGG - Intronic
1021682919 7:23153056-23153078 TGGTTTATCCAGAAGGATGTAGG - Intronic
1022511096 7:30935379-30935401 TGGTTTATAAATAAGGGAGCTGG + Intergenic
1022920356 7:35006992-35007014 TGGGTTAAAAATAAAGAGGAGGG - Intronic
1024399277 7:48905289-48905311 TGGTTTATCATTAAGAAGCAGGG + Intergenic
1027981935 7:85235784-85235806 TGTTTTCTCCATAAGTAGGAAGG + Intergenic
1029534023 7:101145310-101145332 TGGGTTATCAGGAGGGAGGAGGG - Intergenic
1029801714 7:102954737-102954759 TGTTTTATCAGTGAGTAGGATGG - Intronic
1031634051 7:124080638-124080660 CAGTTTGTCAATTAGGAGGACGG + Intergenic
1032346914 7:131124863-131124885 TGGGTTATCTATAAAGGGGAAGG - Intronic
1034361558 7:150503983-150504005 TGTTTTATCACTAAAGAGGAGGG - Intergenic
1036975026 8:13401227-13401249 TTGTTTATCATTAAACAGGAAGG - Intronic
1037981111 8:23255090-23255112 CGGCTTTTCAAAAAGGAGGAAGG - Intronic
1038301844 8:26358240-26358262 TGGATCTTTAATAAGGAGGATGG + Intronic
1038807558 8:30809361-30809383 TTATGTATCAACAAGGAGGATGG + Intronic
1040817586 8:51525509-51525531 TTGTTTACCAAAACGGAGGAGGG - Intronic
1041146125 8:54877744-54877766 TGGATGATCTAAAAGGAGGATGG + Intergenic
1042443674 8:68858469-68858491 TGCTATATCAATAAGAATGAAGG + Intergenic
1044511855 8:93090658-93090680 TGGTTTAGCAATAAGAATTAAGG + Intergenic
1044527233 8:93265671-93265693 TGGGTTATTATTAAGGAGAAAGG - Intergenic
1045886372 8:107102844-107102866 TGGCTTTACAATAAGGAGGATGG - Intergenic
1047427101 8:124756499-124756521 TGTTTTATAAATAAGGATGAAGG + Intergenic
1048458316 8:134598450-134598472 TGGTTTATTAAGAAGAATGAAGG + Intronic
1048765197 8:137836235-137836257 TGGTTTACCATCTAGGAGGATGG - Intergenic
1048851566 8:138650232-138650254 TGGTTTCTGAACAAGGAAGAAGG + Intronic
1049944919 9:585001-585023 GGGTTTAACAATAAGGAAGGGGG - Intronic
1049949105 9:627263-627285 TGGTTTAGGGAGAAGGAGGAGGG - Intronic
1050115436 9:2258703-2258725 TGGTCTTTGGATAAGGAGGAAGG + Intergenic
1050602106 9:7263271-7263293 GGATTTATCAACAAGGAGGCAGG + Intergenic
1055060487 9:72063689-72063711 TGATTTATCACTAATGAGGAGGG - Intronic
1056245908 9:84695121-84695143 TGATCTATCTATAAGGAGGGAGG + Intronic
1056339999 9:85619408-85619430 TAGTTTAAAAATAATGAGGAAGG - Intronic
1056712979 9:89006291-89006313 GGATTTATCAAAAGGGAGGAGGG + Intergenic
1057066889 9:92061543-92061565 TAGATTATCAGGAAGGAGGAAGG + Intronic
1057068276 9:92074703-92074725 TGGTTTTTGAATAGGTAGGATGG - Intronic
1061009584 9:127947025-127947047 TGGTGTGGCAATTAGGAGGAGGG - Intronic
1186285856 X:8043509-8043531 TGGTTGTGAAATAAGGAGGAAGG + Intergenic
1191731332 X:64338901-64338923 TGGTTTAGCAACCAGGTGGATGG + Intronic
1196381060 X:115090042-115090064 TGGTTTTTCAATGAGGTGTAAGG + Intergenic
1199315135 X:146367968-146367990 TGGTTTTTCAAAAGGGAGGAAGG + Intergenic
1200293748 X:154896451-154896473 TGGTTTGTCAAGAAGCAGGCTGG - Intronic
1200834852 Y:7723541-7723563 TGGCTTCTGAGTAAGGAGGAGGG - Intergenic