ID: 978760415

View in Genome Browser
Species Human (GRCh38)
Location 4:112351270-112351292
Sequence GCAGTGAACTGGACAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 1, 2: 6, 3: 40, 4: 334}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978760411_978760415 12 Left 978760411 4:112351235-112351257 CCTTGAGAAGTCAAGTTTGGTAA 0: 1
1: 0
2: 1
3: 12
4: 165
Right 978760415 4:112351270-112351292 GCAGTGAACTGGACAGAGGAGGG 0: 1
1: 1
2: 6
3: 40
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978760415 Original CRISPR GCAGTGAACTGGACAGAGGA GGG Intronic
901390555 1:8943207-8943229 GCAGTGTGCTGTACAGCGGAGGG + Intergenic
902389813 1:16096664-16096686 GCTGTGAACAGGACAGAGGCTGG - Intergenic
902762050 1:18587803-18587825 GCTGAGAACTGGGCAGATGAGGG - Intergenic
903360360 1:22773153-22773175 GCAGTGAAGTATACAGAGCAAGG + Intronic
903539461 1:24089009-24089031 GGAGTGAACTTCACAGTGGAGGG - Intronic
903931390 1:26864296-26864318 GCTGAGAACTGGACAGTGGCAGG + Exonic
904899263 1:33843674-33843696 GCAGGGAGCAGGACAGAGCAGGG + Intronic
907261019 1:53218764-53218786 GCAAAGAACTGGAGAGATGAAGG + Intronic
907759991 1:57348313-57348335 GCTGTGAACAGGATAGAGGGAGG + Intronic
908007872 1:59745284-59745306 GCAGGGAACTTGAAAGAGCATGG + Intronic
912545625 1:110449079-110449101 GGAGTGAGCTGGACAGAGCCTGG - Intergenic
912945581 1:114081387-114081409 GCTCTAAACTGGACAGTGGAAGG + Intergenic
913604245 1:120450367-120450389 GCAGTGCAGTGTACAGAGCAGGG + Intergenic
913641117 1:120813078-120813100 GCAGTGCAGTGTACAGAGCAGGG + Intronic
914277366 1:146137246-146137268 GCAGTGCAGTGTACAGAGCAGGG - Intronic
914364674 1:146967636-146967658 GCAGTGCAGTGTACAGAGCAGGG + Intronic
914365441 1:146973923-146973945 GCAGTGCAGTGTACAGAGCAGGG + Intronic
914487005 1:148119516-148119538 GCAGTGCAGTGTACAGAGCAGGG - Intronic
914538414 1:148588194-148588216 GCAGTGCAGTGTACAGAGCAGGG - Intronic
914587340 1:149074661-149074683 GCAGTGCAGTGTACAGAGCAGGG - Intronic
915315890 1:155029114-155029136 GCAGTCACCAGGACTGAGGATGG + Intronic
915981011 1:160419992-160420014 GAAGTGACCTGGCCAGAGGAGGG + Intronic
917621179 1:176797711-176797733 GCAGTGAGATGGACAGGGAAGGG - Intronic
920438596 1:205963898-205963920 GCAGTGACCAGGAGAGAGGAAGG + Intergenic
920874671 1:209822953-209822975 GTGGGGAACTGCACAGAGGATGG - Intergenic
921608239 1:217179891-217179913 GCAGTGAATTAGCCAGAGCAGGG - Intergenic
921985140 1:221304668-221304690 GCACTGAGCTGGAAGGAGGAGGG - Intergenic
922775404 1:228212201-228212223 GCAGTGAGCTGGTCCAAGGACGG + Exonic
923006708 1:230055734-230055756 GCAGTGAGCTGGAAAGACAATGG - Intergenic
923124101 1:231020633-231020655 CCACTGAACTGCACAGAGGTGGG - Intronic
923480179 1:234376379-234376401 GCAGTGACCTGGAGAGAGGTTGG - Intronic
1063330874 10:5157963-5157985 GCAGTGAACTGGAAACAATAAGG + Intergenic
1064229173 10:13514477-13514499 GCAATGAACTGGAAAGAAGATGG - Intronic
1065193774 10:23240901-23240923 GCACTGAAAAGGACAGAGAAAGG + Intergenic
1065595773 10:27309577-27309599 CCAGTGATCTTTACAGAGGAAGG + Intergenic
1066662841 10:37753375-37753397 GGGGTGAACTGGACAGAAGGCGG - Intergenic
1067899418 10:50223399-50223421 TCAGTGAGCTGCACAGAGGCTGG - Intronic
1068777462 10:60883552-60883574 TCAGTGAGCTGGACAAAGAAGGG + Intronic
1070435173 10:76384071-76384093 ACAGTGAACAGGACAGATTAAGG - Intronic
1070775448 10:79107176-79107198 ACAGTGAAGTGGCCAGAAGATGG - Intronic
1070793825 10:79205378-79205400 GCAGTTAACTGTCCAAAGGATGG - Intronic
1070825329 10:79387337-79387359 TGTGTGAACTGGACAGCGGAAGG + Intronic
1071489248 10:86124822-86124844 ACAGGGAACTGGACAGAGCCAGG + Intronic
1071773959 10:88763797-88763819 GCTCTCCACTGGACAGAGGATGG + Intronic
1073109654 10:101053882-101053904 TCAGTGAACTGGTCAGCTGAGGG + Intergenic
1073134109 10:101210425-101210447 GCAGTGAGCTGGGCAGACTATGG - Intergenic
1073293943 10:102427191-102427213 GCAGAGAAGGGGACAGAGAAAGG - Intronic
1073473963 10:103740907-103740929 GCAGTGAACCAGACAGATGAGGG + Intronic
1074189670 10:111124799-111124821 GCAGGAAACTGGAGACAGGAAGG + Intergenic
1074795895 10:116943468-116943490 GCAGTGAAATAAACAGTGGAGGG - Intronic
1074809438 10:117088605-117088627 GCCGTGAAATTGACAAAGGAGGG - Intronic
1074971511 10:118543060-118543082 GCAGGGCACTGTACAAAGGAGGG - Intergenic
1074978305 10:118598659-118598681 GAAGTAAAATGGACAGAGGTGGG - Intergenic
1075956160 10:126524895-126524917 TCAGTGAGCTTGACAAAGGAGGG - Intronic
1076736430 10:132461212-132461234 GGAGGGAACTTGACAGTGGAGGG - Intergenic
1077250347 11:1558067-1558089 GCAGGGACCTGGCTAGAGGAAGG - Intronic
1078718669 11:13863156-13863178 TCAGTGAACATGACAGAGGTAGG + Intergenic
1079522547 11:21345455-21345477 GCTGTGAAGTTGACAGAGCAGGG + Intronic
1080049735 11:27847296-27847318 GCAGAGAACTGGGAGGAGGAAGG + Intergenic
1081228505 11:40555209-40555231 GCAGTGAAATAGAAAAAGGAAGG - Intronic
1081678659 11:44986492-44986514 GCAGTGAACTGGACTGCACAGGG - Intergenic
1081739224 11:45426466-45426488 AAAGTGAACTGGGCAGAGGAGGG + Intergenic
1082100545 11:48169635-48169657 GCAGTGATGTGGGCAGAGCAGGG - Intronic
1083823701 11:65186626-65186648 CTGGTGAACTGGACAGAGGATGG - Intronic
1084403651 11:68959075-68959097 GCAGTGACCTGAAGAAAGGAAGG + Intergenic
1085036265 11:73302129-73302151 GCAGTGACCTGGACAGAGATGGG + Intergenic
1085663801 11:78394614-78394636 GCACCAATCTGGACAGAGGAAGG + Intronic
1087174045 11:95079977-95079999 TCAGTGGCATGGACAGAGGAAGG - Intergenic
1089568611 11:119387130-119387152 CCAGGGAACTGGACAGATGGTGG - Intergenic
1090407568 11:126486301-126486323 GCATCAAACTGGAGAGAGGAAGG + Intronic
1091754686 12:3043742-3043764 AGAGTGAACAGGAGAGAGGAGGG + Intergenic
1093151985 12:15632820-15632842 GCCGTGAAGTGGACTGATGAAGG - Intronic
1093555337 12:20466131-20466153 TCAGTGTACTGGACAAAGGGTGG - Intronic
1094354778 12:29565984-29566006 GCAGTTTACTGGGTAGAGGAGGG + Intronic
1095551887 12:43451862-43451884 ACAGAGAGCTGGAAAGAGGAAGG + Intronic
1095785792 12:46107676-46107698 GCCGGGAACTGGGCAGAGGGAGG + Intergenic
1095989221 12:48022911-48022933 GGAGTGAAGTGGAGAGGGGAGGG - Intronic
1099477436 12:83124015-83124037 GAAGAGGACTGCACAGAGGATGG - Intronic
1099768633 12:87023179-87023201 GCAGTTAAAAGGACAAAGGAGGG + Intergenic
1100461930 12:94808350-94808372 GCACGGTCCTGGACAGAGGATGG - Intergenic
1101139711 12:101782770-101782792 GGAGTGAACAAGACAGAGGCAGG - Intronic
1101411846 12:104475388-104475410 TCAGGGAACTTGACAGAGGAAGG + Intronic
1101632071 12:106504886-106504908 GCAGTGAACAAGACAGTGGATGG + Intronic
1102164656 12:110796735-110796757 GCAGTGAGCTGGACCAAGGTGGG + Intergenic
1102235459 12:111291648-111291670 GCAGGGAACTGGGCAGGTGAAGG + Intronic
1102947657 12:117004058-117004080 GCAGTGAGCAGCACGGAGGAGGG - Intronic
1103028455 12:117593019-117593041 GCTATGATCTGGAAAGAGGAGGG + Intronic
1103864741 12:124042852-124042874 GCAGGGTACTGGGCAGAGGAAGG - Intronic
1103963719 12:124624999-124625021 GCAGTGCACTGCACCGTGGATGG - Intergenic
1104675690 12:130710509-130710531 GCAGTGAACAAGCTAGAGGAGGG - Intronic
1106379573 13:29223359-29223381 GCTGAGAACTGAACAGATGATGG + Intronic
1107390321 13:39956567-39956589 GCAGAGACCTGGACAGAGGAAGG + Intergenic
1107671056 13:42746693-42746715 GCAGTCAACGGCACAGGGGAAGG - Intergenic
1108314369 13:49222923-49222945 GCTGTGATCTGGAGAGAGGTGGG - Intergenic
1109097106 13:58133120-58133142 GCACGGAACTGGACTGAGGCTGG - Intergenic
1111396991 13:87677261-87677283 GCAGGGACCTGGATAGAGGAGGG - Exonic
1112105911 13:96239030-96239052 GCAATGATATGGACTGAGGAAGG + Intronic
1113291561 13:108912059-108912081 GCAGGGTACTGGAGAGAGGAGGG + Intronic
1115262387 14:31467299-31467321 GAAATGAACAGGGCAGAGGAGGG - Intergenic
1117337047 14:54764910-54764932 TCAGGGAACTGGAGAGAGGAAGG + Intronic
1117571711 14:57055510-57055532 ACAGTGAAGGGGACAGTGGATGG + Intergenic
1119109324 14:71956983-71957005 TAAGTGAGCTGAACAGAGGAAGG + Intronic
1119715634 14:76857087-76857109 GCAGTGAGATGGACAGATGGTGG + Intronic
1120114567 14:80599217-80599239 GCAGTGAACTGCACAAGGAAGGG - Intronic
1120842041 14:89094541-89094563 GCAGTGGGCTGGACAGGGGCTGG + Intergenic
1121877340 14:97465316-97465338 GAAGAGGACTGGAAAGAGGAGGG + Intergenic
1121937616 14:98034734-98034756 GCAGAGAACAGGACTGAGCATGG + Intergenic
1121963571 14:98283642-98283664 GCAGTGAAGTGGAAAGGGAATGG + Intergenic
1202917990 14_KI270723v1_random:2983-3005 ACAGAGAACTGGCCGGAGGAAGG - Intergenic
1124140122 15:27070016-27070038 GAAGTGAATTAGAGAGAGGAAGG + Intronic
1125332833 15:38599011-38599033 GCAGTGAACTTGACTGATAATGG + Intergenic
1126088354 15:45029796-45029818 GAAGGGAACTGGAGAGGGGATGG + Intronic
1126150999 15:45523244-45523266 GCAGTCAACTGGAGAGGGCAAGG + Intergenic
1126223245 15:46239827-46239849 GCAGTGAAGTGGGCTGAGGCTGG + Intergenic
1126782467 15:52150423-52150445 GCAGAGAAATGGACAGAGAATGG - Intronic
1127395210 15:58539049-58539071 GCAGTGAACTGGAAGGAGCTGGG - Intronic
1128297481 15:66536594-66536616 GAAGTGAACTGTCCAGTGGAAGG + Intronic
1129160505 15:73745043-73745065 GCTGTGACCAGGACAGAGGTTGG - Intronic
1129737303 15:77973476-77973498 GCAGTGAGCCTGCCAGAGGAAGG + Intergenic
1129825849 15:78634614-78634636 GCAGCTACCTGGCCAGAGGAGGG + Intronic
1129848769 15:78780149-78780171 GCAGTGAGCCTGCCAGAGGAAGG - Intronic
1130625376 15:85508594-85508616 GCGGAGAACAGGACAGAGCAAGG - Intronic
1130730245 15:86484315-86484337 GGAAAGAACTGCACAGAGGAGGG + Intronic
1130949563 15:88574730-88574752 GGTGTGAAGTGCACAGAGGAGGG - Intergenic
1131791275 15:95968251-95968273 GCAATGAACAGGAAAGAAGATGG + Intergenic
1133252214 16:4490337-4490359 TCAGTGAACTGCAGGGAGGATGG - Intronic
1135505201 16:23030405-23030427 GCAGTGAGCTGCACAGAGAATGG + Intergenic
1136385659 16:29924465-29924487 GCAGTGAACTGGACGGGGGGAGG - Intronic
1137508991 16:49081669-49081691 GGAGTGAACAGAGCAGAGGAAGG - Intergenic
1137944166 16:52717744-52717766 GCAGTGAACTGCACAGAAAAGGG - Intergenic
1140215026 16:73000225-73000247 CCAGGGCACTGGAGAGAGGAGGG + Intronic
1140550596 16:75861703-75861725 GCAGGGAAGTGGCCAGACGATGG - Intergenic
1141107128 16:81242886-81242908 GTCGTGAACTGCACATAGGAGGG + Intronic
1141430948 16:83969883-83969905 GCAGGGAAGAGGAGAGAGGAAGG - Intronic
1142027672 16:87823296-87823318 GCAGTGAACAGGTCAGTGCAGGG + Intergenic
1142206922 16:88787708-88787730 GCAGTGAACTGGGCACAGGTGGG - Intergenic
1142508982 17:382828-382850 ACAGTGACCTGCACAGAGAAGGG + Intronic
1143029234 17:3958416-3958438 TCTGTGAACAGGACAGAGGCAGG - Intronic
1143250066 17:5516814-5516836 ACAGTGTAGTGGAAAGAGGATGG - Intronic
1143702909 17:8674848-8674870 GCAATGAACAGGACAGGGGCAGG - Intergenic
1146248202 17:31310285-31310307 GCAGCGAACAGAAAAGAGGAAGG + Intronic
1146400119 17:32495145-32495167 GCATGGGACTGGACAGTGGAGGG + Intronic
1147647344 17:42041644-42041666 TCACTGAGCTGGACAGTGGAGGG - Intronic
1149580341 17:57745587-57745609 GAAGTAAACTGGCCAGAGCAAGG + Intergenic
1149884698 17:60328291-60328313 GCTGAGAGCTGGACAGATGATGG + Intronic
1149884708 17:60328347-60328369 GCTGAGAGCTGGACCGAGGATGG + Intronic
1150821195 17:68435801-68435823 ACAGGGAGCTGGACAAAGGAGGG - Intronic
1151297680 17:73197497-73197519 GCAGTGAACTGGACAAATAGAGG + Intronic
1152168511 17:78726970-78726992 AGAGAGAACTGGAAAGAGGATGG - Intronic
1152345158 17:79746982-79747004 GCCAGGAACTGGGCAGAGGAGGG + Intergenic
1152838140 17:82548705-82548727 GCTGTGGACTGAATAGAGGAAGG + Intronic
1153718034 18:7870616-7870638 GCAGTGTAATGAAGAGAGGAGGG - Intronic
1154350582 18:13579989-13580011 GCAGTGAACTAGAGGAAGGAAGG - Intronic
1154361829 18:13669386-13669408 TCAGTGAACAGGGCAGAGAATGG - Intronic
1155977217 18:32143685-32143707 ACAGTGAACTGGATGGGGGATGG + Intronic
1155985626 18:32227797-32227819 TCAGTGAACTGGGGAAAGGAAGG + Intronic
1157248071 18:46071398-46071420 GAAGAGGACTAGACAGAGGAGGG + Intronic
1158290254 18:55932614-55932636 GAAGGGAGCTGGAAAGAGGATGG - Intergenic
1158422196 18:57305046-57305068 GCTGTGCAGTGGACAAAGGATGG - Intergenic
1158725538 18:59968452-59968474 GCAGTGAATTGGACAGAGTTGGG + Intergenic
1158878955 18:61758008-61758030 GAAATGAACAGCACAGAGGATGG + Intergenic
1158916425 18:62136017-62136039 GCAGTGAACAGGATAGACAAAGG - Intronic
1160346110 18:78134266-78134288 GCAGTGAACTAGACAGGAAATGG + Intergenic
1160810216 19:1010052-1010074 GCAGTGAACCGTCCTGAGGATGG - Exonic
1162740913 19:12773106-12773128 GAAGTGAGGTGGAGAGAGGATGG - Intronic
1162893014 19:13747710-13747732 GTAGTGGGCTGGACAGAGGATGG + Intronic
1163386754 19:17004661-17004683 GCAGTGAGCTGGACAAACGAGGG + Intronic
1164609756 19:29624056-29624078 GCAGTGAACTGGAGAGGCCAAGG + Intergenic
1165479095 19:36051400-36051422 GAAGGGATCTGGGCAGAGGAGGG + Intronic
1165641368 19:37390415-37390437 GCAGTGGACTGGTCACAGGCTGG + Exonic
1165768930 19:38367327-38367349 GCAGTGAACTGTGCAGGGGAAGG - Intronic
1166259135 19:41625912-41625934 ATAGTGAACTGGACAGTGGTGGG + Exonic
1166368963 19:42291091-42291113 GCAATGAACTGGACAGCAGGGGG - Exonic
1167435181 19:49474928-49474950 GCGGGGAGATGGACAGAGGAGGG + Intronic
925922680 2:8647721-8647743 GCAGGGTAGAGGACAGAGGATGG + Intergenic
926042738 2:9687585-9687607 GCAGTTAAATGGAGAGGGGAGGG + Intergenic
927699311 2:25257935-25257957 GAAGTGGTCTGGAGAGAGGAGGG + Intronic
927708540 2:25311511-25311533 GCAGTGATCTGGATAGATAAGGG - Intronic
927711871 2:25331202-25331224 GCTGGGGACTGGACAGATGATGG - Intronic
928200072 2:29242192-29242214 GCAGTGAGCAGGACAGAGTTGGG - Intronic
928681678 2:33709104-33709126 GCAGTGAACAAGACAGAAAAAGG - Intergenic
929145280 2:38701929-38701951 GGAGTGAAATGGAAAGAGTAAGG - Intronic
930029055 2:47047316-47047338 ACAGTGAAATTTACAGAGGAGGG + Intronic
931655256 2:64504996-64505018 GCAGAGAAATGGGGAGAGGAAGG + Intergenic
932110314 2:68993247-68993269 GCAGTGACCTGGACAGACTGCGG + Intergenic
932393707 2:71422532-71422554 GGGGTTAACTTGACAGAGGAGGG + Intronic
934560550 2:95310984-95311006 GCACTGAACAGGACCAAGGAGGG - Intronic
934702861 2:96455839-96455861 ACACAGAACTGGACAGAGAATGG + Intergenic
937062288 2:118989588-118989610 GCAGTGTGCTGGTCAGTGGAGGG - Intronic
937338616 2:121076929-121076951 CCAGTGAACTGGACTGAGTCGGG - Intergenic
938826796 2:135013737-135013759 GCAGGGAGCAGGACAGAGGAGGG - Intronic
939029125 2:137049183-137049205 GCATTGAGCTGGACAGAGACAGG + Intronic
940440223 2:153706515-153706537 CCAGTGAAATGGACGGAGCAAGG + Intergenic
940753738 2:157658296-157658318 ACAGTGAAGTGGACAGAGAGTGG + Intergenic
942268267 2:174248748-174248770 GCAGGGAGCTGGAGAGGGGAAGG + Intergenic
943000693 2:182324770-182324792 GCAGTCAACTGTACAGTGAATGG - Intronic
944563287 2:200963250-200963272 GCAGCCAACTGGCCAGAGGCTGG - Intronic
944927684 2:204481828-204481850 ACAGTGTTCTGGACACAGGAGGG - Intergenic
944938461 2:204595231-204595253 GCAGTGGATGGGACAGAGGATGG - Intronic
945024212 2:205605222-205605244 GCACAGAACTGGGCAGAGGCTGG - Intronic
945709277 2:213276180-213276202 GAAGTGAACAAGATAGAGGAGGG + Intergenic
946506942 2:220311961-220311983 GTGGAGGACTGGACAGAGGACGG - Intergenic
946682826 2:222235271-222235293 GCAGTGAACAAGGCAGAGAAGGG - Intronic
947036778 2:225867858-225867880 ACAGTGAACTGCACAAAGGCAGG - Intergenic
947735017 2:232449828-232449850 GCAGTGACCTGGCCTGGGGAAGG + Intergenic
948028969 2:234800927-234800949 GCAGAGAATGGGAGAGAGGAAGG - Intergenic
948523945 2:238559058-238559080 GCAGCGATCCGGACAGAGGGGGG + Intergenic
1170142102 20:13134704-13134726 GAAGTAAAGTGAACAGAGGATGG + Intronic
1170622583 20:18008030-18008052 GCAGAGACCAGGACAGAGGAAGG + Intronic
1170927712 20:20741169-20741191 GCACAGAACAGGACAGAGAAAGG - Intergenic
1171824235 20:29879320-29879342 TGGGTGAACTGGATAGAGGAGGG + Intergenic
1172116444 20:32576145-32576167 GGAGGGTTCTGGACAGAGGAGGG + Intronic
1172154233 20:32812380-32812402 GCAGGGAAGTGGAGACAGGATGG - Intergenic
1172181083 20:33004023-33004045 GCCGGGAAATGCACAGAGGACGG - Intronic
1172463241 20:35135902-35135924 GCAGAGAACTGGACTGGGGCTGG - Intronic
1174897559 20:54467060-54467082 GCAGTGACCTGCAGAGAGGAGGG + Intergenic
1174983926 20:55428303-55428325 ACAGTGAGCTGGAAAGAGGTGGG + Intergenic
1175702001 20:61146198-61146220 GCATTCAGCTGGACAGAGGCTGG + Intergenic
1176254237 20:64142532-64142554 GCAGTGGGCTGGGCAGAGGGAGG + Intergenic
1179248963 21:39656977-39656999 GCAGTGACCTAGGCAGAGGGCGG + Intronic
1180038513 21:45263658-45263680 GCAGTCTAATGAACAGAGGAGGG + Intergenic
1180080099 21:45482733-45482755 GCAGCACAGTGGACAGAGGAAGG - Intronic
1180141101 21:45893711-45893733 GCACTGGACGGGACAGAGGGAGG + Intronic
1181140019 22:20797484-20797506 GCAGAGAATGGGACAGAGGAAGG + Intronic
1181776862 22:25166209-25166231 GCAGTGAAGGAGAGAGAGGAGGG + Intronic
1182559563 22:31149096-31149118 CCAGGGAAATGGAAAGAGGAAGG + Intergenic
1182782181 22:32877044-32877066 GCATAGCAATGGACAGAGGAAGG - Intronic
1183093401 22:35538833-35538855 GCAGTGAACTTGGCAGTGGGAGG - Intergenic
1184001529 22:41677856-41677878 GCAGAGAACTGAATAGATGAGGG - Intronic
1184315981 22:43689665-43689687 GAATTGAAATGCACAGAGGAAGG - Intronic
1184320303 22:43736889-43736911 GGAGTGAACTGGAAAGATGGGGG - Intronic
1184499158 22:44861542-44861564 GCAGAGAACTGGAGGGAGGCAGG - Intronic
1184658034 22:45951999-45952021 GCAGTGAGCTGGAAGGAGGGGGG + Intronic
1184831414 22:46991138-46991160 TCTGTGAAATGGAGAGAGGAAGG - Intronic
949319244 3:2790291-2790313 GAAGTGAACTGGAGAGAGAAAGG + Intronic
950043598 3:9935255-9935277 GGAGGGAATTGGGCAGAGGATGG + Intronic
950427816 3:12934117-12934139 GCAATGCGCTGGACAGGGGAGGG - Intronic
952220786 3:31322048-31322070 GCAGTGAGAAGGACAGAGGAAGG - Intergenic
952879087 3:37971785-37971807 CCAGTGTAATGGACAAAGGATGG + Intronic
952918343 3:38266664-38266686 GCAGTGAAATGGACAGGGAAAGG - Intronic
953081457 3:39623503-39623525 ACAGTGGAATGGAGAGAGGAGGG + Intergenic
953974685 3:47373257-47373279 GCTGTGAACTGCACAGGTGAGGG + Intergenic
954606174 3:51911607-51911629 GCAGTGAGATGGACAGAGCGAGG + Intergenic
955910950 3:63859694-63859716 GCAGTGAACTAGACAGAGGAGGG - Intronic
956896099 3:73661667-73661689 GCAGTGAATTAGAAAGAGGCAGG - Intergenic
957322709 3:78653209-78653231 GCAGGGAACTGGAGGGAGGCAGG - Intronic
957503620 3:81091129-81091151 GCTGTGAACTGCACATGGGAGGG - Intergenic
958693420 3:97497565-97497587 GCAGTGAATTAGAAAGAGAAAGG - Intronic
959371627 3:105534069-105534091 GCTGTGAACTGCACATATGAGGG - Intronic
959565270 3:107826689-107826711 ACAGTGAAGGTGACAGAGGATGG - Intergenic
960148351 3:114227070-114227092 TCAATCAACTGTACAGAGGATGG - Intergenic
960571591 3:119190002-119190024 TCAGGAAACTGGACTGAGGAAGG + Intronic
960622612 3:119651480-119651502 TCAGTGAACAGAACAGATGAAGG - Intronic
960646543 3:119891110-119891132 ACACTGCACTGGAAAGAGGAAGG + Intronic
961205228 3:125076373-125076395 GCAGTTAGCTGCAGAGAGGACGG - Intergenic
963985653 3:151591004-151591026 GGAGTGAACTGGAGAAAGGGAGG + Intergenic
967469780 3:189848283-189848305 GGAGTGCACTGGTCTGAGGATGG + Intronic
967835937 3:193962770-193962792 GCACTGATCTGGACAGTGGAAGG + Intergenic
967888343 3:194347818-194347840 GGGCTGAACTGGGCAGAGGATGG - Intronic
967888366 3:194347896-194347918 GGGCTGAACTGGGCAGAGGATGG - Intronic
967888422 3:194348075-194348097 GGGCTGAACTGGGCAGAGGATGG - Intronic
967888445 3:194348153-194348175 GGGCTGAACTGGGCAGAGGATGG - Intronic
969376038 4:6763813-6763835 TCAGTGAACTGCACAGAGGAAGG + Intergenic
970345752 4:15150581-15150603 GCAGTGAAGGGGATGGAGGAAGG - Intergenic
970943400 4:21661724-21661746 GCAGTGAACTAGATGGAGGGTGG - Intronic
971075894 4:23149020-23149042 GCAGTCATCTGGGCTGAGGAAGG + Intergenic
972613028 4:40672627-40672649 GGAGTGAGCCGGAAAGAGGAAGG + Intergenic
973194026 4:47419227-47419249 GCAGTGCACTGGAGGAAGGAAGG + Intronic
973732958 4:53841210-53841232 GCAGTGAAATAGACATAGTAGGG + Intronic
973863838 4:55092082-55092104 GCAATGACCTGGAAAGGGGAGGG - Intronic
975339590 4:73224440-73224462 GCAGTCAACTAGACAGATTATGG + Intronic
976198093 4:82552499-82552521 GCAGGGAAATGGACACATGAAGG - Intronic
977489302 4:97691775-97691797 GAAGTGAAGTGGACACAGGGAGG - Intronic
977836390 4:101650218-101650240 GCTGTGAAGTGAGCAGAGGAAGG - Intronic
978233095 4:106424386-106424408 GCAGAGAAGGGGACAGAAGAGGG - Intergenic
978445081 4:108772638-108772660 GGAGTGAAATGGAGAGAGGTGGG - Intergenic
978760415 4:112351270-112351292 GCAGTGAACTGGACAGAGGAGGG + Intronic
979449550 4:120854184-120854206 ACATTCAACTGGAGAGAGGAGGG + Intronic
980397813 4:132238429-132238451 TAACTGAAGTGGACAGAGGATGG + Intergenic
980869649 4:138595914-138595936 GCAGGGAGCAGGACACAGGAAGG - Intergenic
980896956 4:138869046-138869068 GGAGGGAAGTGGAGAGAGGAGGG + Intergenic
983889841 4:173019283-173019305 GCAAGGAACTGGACATAAGATGG + Intronic
985122187 4:186655352-186655374 CCAGTGAAATGGACAGTGAAAGG + Intronic
985696906 5:1345774-1345796 CCAGAGAACTGGCCAAAGGACGG - Intergenic
985787106 5:1902184-1902206 GAACTGCACTGGACAGGGGAGGG + Intergenic
985912793 5:2896550-2896572 GCAGAGAACAGGGCAGAGGCCGG - Intergenic
986216713 5:5726158-5726180 GCAGTGCAGTGGAAAGAGTAAGG - Intergenic
986602559 5:9487516-9487538 GCAGTGAAATGGGGAGAGGAAGG + Intronic
986797946 5:11230917-11230939 GCAGTGAGGTGAACTGAGGAGGG - Intronic
988137164 5:27188796-27188818 GCACTGAACTGCTCAGAGGTAGG + Intergenic
991467332 5:66927681-66927703 GCAATGTACTGGACCCAGGAAGG + Intronic
991987247 5:72301822-72301844 GCAGAAAACTGCACAGAGCAGGG + Intronic
992658216 5:78931501-78931523 GCAGTGAAATGGCCAGAGACAGG - Intronic
994966685 5:106681542-106681564 GCAGTGAAGTGGGCAGGGGCAGG - Intergenic
995066757 5:107871127-107871149 GCAATGAACCTGACAGAGGCAGG + Intronic
996126825 5:119735474-119735496 ACTGTGAACTTAACAGAGGAAGG + Intergenic
996283698 5:121763814-121763836 GCAGGGAAGTGGAAGGAGGAAGG + Intergenic
997660624 5:135586749-135586771 GCAGGGATCTGGGCAGGGGAGGG + Intergenic
998184583 5:139968561-139968583 GCAGGGGACTGGAAGGAGGAAGG + Intronic
1001795975 5:174502651-174502673 GCAGGGAGGTGGACAGAGGTGGG + Intergenic
1002078738 5:176725465-176725487 GCAGGGAGCTGGAGAGAGGGTGG + Intergenic
1002096793 5:176836110-176836132 GCAGTGAGCTGGACAGAGAATGG + Intronic
1002718722 5:181245449-181245471 GCTGTGAACAAGACAGAGGGGGG + Intronic
1002907233 6:1459077-1459099 GCAGAGCCCTGGACAAAGGACGG - Intergenic
1003026245 6:2558217-2558239 GCAGTGAATGGGACAGAGAGAGG + Intergenic
1004772115 6:18795798-18795820 AGAGTGAGCAGGACAGAGGAGGG + Intergenic
1005850100 6:29814595-29814617 GCTGCAAAGTGGACAGAGGATGG + Intergenic
1006405331 6:33841687-33841709 GCACTGGGCTGGACAGAAGATGG - Intergenic
1006451572 6:34108691-34108713 GCACTGAACTGGACATTGGGAGG - Intronic
1007119239 6:39366599-39366621 GCAGTGACCTGAATGGAGGAAGG + Intronic
1008980244 6:57474859-57474881 GCATTGAAGTGCACAGAGGTAGG - Intronic
1009168345 6:60367799-60367821 GCATTGAAGTGCACAGAGGTAGG - Intergenic
1010759182 6:79702730-79702752 ACAGTGATCAGGACTGAGGATGG + Exonic
1011259069 6:85453115-85453137 GCAGAAAACTGGGAAGAGGATGG + Intronic
1012301203 6:97590719-97590741 GCAGTGAACAGGAAAAAGCATGG - Intergenic
1013205594 6:107942390-107942412 CCAGGGAACTGGAAAGAGGAGGG - Intronic
1013933345 6:115563290-115563312 GTAGTCAACTAGATAGAGGAAGG + Intergenic
1014880527 6:126718632-126718654 GCAGTGAAATTGACATTGGAAGG - Intergenic
1015513697 6:134064048-134064070 CCAGTGCAATGGACAGAAGAGGG + Intergenic
1016023453 6:139259718-139259740 GCCGTGAACAAGACAGAGAAGGG - Intronic
1016814299 6:148289465-148289487 GCAGTGAAGTGGTCAGAGGAAGG + Intronic
1017087352 6:150726000-150726022 GAAATGAACTGGACATAGAAGGG + Intronic
1017808560 6:157967242-157967264 CCAGGGACCTGGACAGAGGGAGG + Intergenic
1021280514 7:18711302-18711324 GCAGTGGGTTGGAGAGAGGAAGG - Intronic
1022457673 7:30573175-30573197 ATAGTGGACTGGCCAGAGGAAGG + Intergenic
1022955893 7:35379737-35379759 ACAGTCAAATGGAAAGAGGAAGG - Intergenic
1023754335 7:43402064-43402086 GTGGTGAGCTGGAAAGAGGATGG - Intronic
1023863258 7:44227543-44227565 GGAGTGTAGGGGACAGAGGAGGG + Intronic
1024002850 7:45202417-45202439 GCAGTGTCCTGGAAGGAGGATGG + Intergenic
1024066790 7:45744253-45744275 GGAGTGAAGTAGAGAGAGGAAGG + Intergenic
1026666881 7:72348443-72348465 GCAGAGAACTGGAGAGGAGAAGG + Intronic
1028830600 7:95323225-95323247 GGAGTGACCCAGACAGAGGAAGG - Intronic
1029002388 7:97167821-97167843 GCACTGATCTTGACAGAGGCAGG + Intronic
1029452627 7:100649754-100649776 GGCTGGAACTGGACAGAGGAGGG - Intronic
1030097857 7:105917044-105917066 GCAGCCAACTGGGCAGAGAAAGG + Intronic
1031362413 7:120862499-120862521 GCAGTGAACAGGAGAGAGGATGG - Intergenic
1031382630 7:121106644-121106666 GCTGTGAACAGGACAGGTGAAGG - Intronic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1034974240 7:155438696-155438718 GCAGAGAGCTGGAGACAGGAAGG + Intergenic
1035666999 8:1386651-1386673 GAAGAAACCTGGACAGAGGAAGG + Intergenic
1035669821 8:1408789-1408811 GCAGTGAAAGTGACAGACGAAGG - Intergenic
1036089014 8:5644903-5644925 GGAGAGAACAGGACAGAGGAGGG - Intergenic
1036962561 8:13261240-13261262 GCAGAGACCTGGACAAAGTAAGG + Intronic
1038410851 8:27358235-27358257 GCAGTCAACTCAACTGAGGATGG - Intronic
1039890245 8:41681041-41681063 GCAGTGACCTGGAATGAGCAGGG - Intronic
1040483539 8:47849312-47849334 GAAGGGAACTGGTGAGAGGAGGG + Intronic
1042514579 8:69645660-69645682 GCAGTGATCCAGACACAGGATGG + Intronic
1044221300 8:89672982-89673004 GCAGTAAACTGGAAAAATGAGGG + Intergenic
1044901222 8:96947029-96947051 GCAATGAACTTGACAGACAATGG - Intronic
1045330648 8:101153129-101153151 GCAATGAAGTGGACAGAGCCTGG - Intergenic
1047545422 8:125811737-125811759 GCAGTGATCAGAGCAGAGGAAGG + Intergenic
1048015172 8:130490879-130490901 GCAGTGGCCTGGGCAGCGGAGGG + Intergenic
1048852735 8:138660001-138660023 GCATGGAACGGGACAGAGAAGGG - Intronic
1048982667 8:139711361-139711383 GCAGTTAGGTGGAGAGAGGAGGG - Intergenic
1049142743 8:140971446-140971468 GCAGTTAAATGGACAGTGGTAGG + Intronic
1049570176 8:143366241-143366263 GCAGGGAACTGGACAGCGGCGGG - Intergenic
1051185876 9:14460838-14460860 GCAGAGACCTGGGCAGTGGAAGG - Intergenic
1052228755 9:26121490-26121512 TCCTTGAACAGGACAGAGGATGG + Intergenic
1055832842 9:80402870-80402892 GCATTGAACTGGAAAGACTATGG + Intergenic
1056076058 9:83041663-83041685 GCAGTGGAGTGGACAGATGATGG - Intronic
1056574542 9:87844899-87844921 TCTGTGAACTGGAGAGAGAAAGG + Intergenic
1056812064 9:89772586-89772608 GCAGAGAACAGGAGAGTGGAGGG - Intergenic
1057302087 9:93892481-93892503 GCAGAGGATTGGACACAGGAAGG + Intergenic
1057316888 9:93975296-93975318 GCAGTGCACTGAAGGGAGGATGG + Intergenic
1058115212 9:101077616-101077638 GAAGCTGACTGGACAGAGGAGGG + Intronic
1060825520 9:126685504-126685526 GCAGTGTCCTGGACAAAGGCTGG + Intronic
1061841057 9:133358820-133358842 GGAGGGAAATGGACAGAGGCTGG + Intronic
1061874860 9:133538601-133538623 ACAGTGGTCTGGACAGTGGATGG - Intronic
1062066277 9:134528210-134528232 GCTTTGACTTGGACAGAGGAGGG - Intergenic
1062245898 9:135565888-135565910 GCCCTGAACTGGACACAGTAGGG - Intronic
1062512981 9:136917594-136917616 CCAGTGAGCTGGCCAGGGGAGGG - Intronic
1186846135 X:13532892-13532914 GCACTGAACTGGACTTAGAATGG + Intergenic
1188355332 X:29183652-29183674 GGAGTGAAGAGGAGAGAGGAGGG - Intronic
1188387920 X:29584170-29584192 GCAGTGATATGGACAGAGTATGG - Intronic
1188474226 X:30573387-30573409 GCAGTGAAGTGCAGAAAGGAAGG + Intronic
1193815532 X:86101195-86101217 GCAGGAAATTGGACAGAGGAAGG + Intergenic
1194767719 X:97861742-97861764 GCAGTGAAGTGGGTAAAGGAGGG + Intergenic
1195571405 X:106401932-106401954 GCTGAGGACTGGAAAGAGGACGG + Intergenic
1198465683 X:136902744-136902766 GAAGTGAACTGGAAAGAGGATGG + Intergenic
1199452083 X:147989013-147989035 GCAGAAAACTGGATAGAGAATGG - Intronic
1199794454 X:151180904-151180926 GCCTTGAAATGGACAGAGGCAGG - Exonic
1199882507 X:151985831-151985853 GAAGAGAGCTGGGCAGAGGATGG + Intergenic