ID: 978761460

View in Genome Browser
Species Human (GRCh38)
Location 4:112358859-112358881
Sequence TTCCGATGACTTTGCTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 81}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978761448_978761460 20 Left 978761448 4:112358816-112358838 CCAACTTTGCCACCTTCACCCAG 0: 2
1: 0
2: 3
3: 16
4: 270
Right 978761460 4:112358859-112358881 TTCCGATGACTTTGCTGCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 81
978761458_978761460 -5 Left 978761458 4:112358841-112358863 CCTGCAGGACCACAAGGGTTCCG 0: 1
1: 1
2: 0
3: 6
4: 84
Right 978761460 4:112358859-112358881 TTCCGATGACTTTGCTGCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 81
978761457_978761460 -4 Left 978761457 4:112358840-112358862 CCCTGCAGGACCACAAGGGTTCC 0: 1
1: 1
2: 1
3: 14
4: 123
Right 978761460 4:112358859-112358881 TTCCGATGACTTTGCTGCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 81
978761452_978761460 8 Left 978761452 4:112358828-112358850 CCTTCACCCAGGCCCTGCAGGAC 0: 2
1: 0
2: 3
3: 39
4: 433
Right 978761460 4:112358859-112358881 TTCCGATGACTTTGCTGCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 81
978761453_978761460 2 Left 978761453 4:112358834-112358856 CCCAGGCCCTGCAGGACCACAAG 0: 1
1: 1
2: 2
3: 37
4: 296
Right 978761460 4:112358859-112358881 TTCCGATGACTTTGCTGCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 81
978761447_978761460 25 Left 978761447 4:112358811-112358833 CCAAGCCAACTTTGCCACCTTCA 0: 2
1: 0
2: 1
3: 17
4: 257
Right 978761460 4:112358859-112358881 TTCCGATGACTTTGCTGCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 81
978761450_978761460 11 Left 978761450 4:112358825-112358847 CCACCTTCACCCAGGCCCTGCAG 0: 2
1: 0
2: 6
3: 72
4: 598
Right 978761460 4:112358859-112358881 TTCCGATGACTTTGCTGCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 81
978761454_978761460 1 Left 978761454 4:112358835-112358857 CCAGGCCCTGCAGGACCACAAGG 0: 1
1: 1
2: 8
3: 54
4: 384
Right 978761460 4:112358859-112358881 TTCCGATGACTTTGCTGCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978761460 Original CRISPR TTCCGATGACTTTGCTGCCC TGG Intronic