ID: 978764507

View in Genome Browser
Species Human (GRCh38)
Location 4:112390377-112390399
Sequence TTATAGCCAAGCCTATATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 84}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978764507_978764511 19 Left 978764507 4:112390377-112390399 CCTCAATATAGGCTTGGCTATAA 0: 1
1: 0
2: 1
3: 4
4: 84
Right 978764511 4:112390419-112390441 TGCAGTTTACATTTGTTTGTGGG 0: 1
1: 0
2: 0
3: 29
4: 403
978764507_978764512 20 Left 978764507 4:112390377-112390399 CCTCAATATAGGCTTGGCTATAA 0: 1
1: 0
2: 1
3: 4
4: 84
Right 978764512 4:112390420-112390442 GCAGTTTACATTTGTTTGTGGGG 0: 1
1: 0
2: 0
3: 24
4: 354
978764507_978764510 18 Left 978764507 4:112390377-112390399 CCTCAATATAGGCTTGGCTATAA 0: 1
1: 0
2: 1
3: 4
4: 84
Right 978764510 4:112390418-112390440 TTGCAGTTTACATTTGTTTGTGG 0: 1
1: 0
2: 3
3: 33
4: 393

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978764507 Original CRISPR TTATAGCCAAGCCTATATTG AGG (reversed) Intronic
903549168 1:24145771-24145793 TTAAAGACAAGCCTTTGTTGGGG + Intergenic
905878622 1:41449231-41449253 TTCTAGCCAAGCTTGGATTGAGG + Intergenic
908108013 1:60865761-60865783 TTTTAGCCAAGTCAGTATTGGGG + Intronic
910435005 1:87197255-87197277 TTATGGCCAAGAGTATATTATGG + Intergenic
912040713 1:105386342-105386364 TTATGGCCAAATCTATATTACGG + Intergenic
912411668 1:109484327-109484349 ATAAAGGCAAGCCTATATGGGGG - Intronic
919341585 1:196315067-196315089 TTGTAGTAAAGCATATATTGAGG - Intronic
1067316236 10:45166437-45166459 TTATAGGCAAGACTGTATTCTGG - Intergenic
1072394950 10:95029551-95029573 TTATGGCTAAGCATATAGTGTGG + Intergenic
1074562355 10:114545573-114545595 TTATAGCTTTGCCTTTATTGTGG - Intronic
1078685988 11:13532870-13532892 TTACAGACAAGCAAATATTGAGG - Intergenic
1080131141 11:28795998-28796020 TCATACCCAAGCCTATCTTCTGG - Intergenic
1082914993 11:58423772-58423794 TAATAGTCAAGCCTATCTTCTGG + Intergenic
1085492792 11:76936258-76936280 ATAGACCCAAACCTATATTGGGG + Intronic
1086217240 11:84398535-84398557 TTATTGCAAATCCTATATTAAGG - Intronic
1086221269 11:84446598-84446620 TTAAACCCAACCCTATTTTGTGG - Intronic
1086564438 11:88209422-88209444 TAATAGCCAGGCCTACATAGTGG - Intergenic
1095267159 12:40174001-40174023 AAATAGCCAAGCCTATGTTTGGG - Intergenic
1097497518 12:60359202-60359224 TTAGAGCACAGCCTATAGTGGGG + Intergenic
1099644510 12:85335078-85335100 TTATATCCAAACCTAAATTGAGG - Intergenic
1107189483 13:37561979-37562001 TTATAGCCAATGGTGTATTGAGG + Intergenic
1110391458 13:74979850-74979872 TTATGGGCCAGCCTATGTTGTGG + Intergenic
1110917356 13:81038807-81038829 ATATAGCCAAAGCTATTTTGAGG + Intergenic
1117921886 14:60733314-60733336 TTTTAGCCAATACTACATTGAGG - Intergenic
1118150654 14:63186010-63186032 TTAAAGCCTTGACTATATTGTGG - Intergenic
1120034864 14:79685167-79685189 TTATAACAAATCATATATTGAGG + Intronic
1127805341 15:62514024-62514046 TTATAGCAAAGCTAATGTTGAGG - Intronic
1128422418 15:67506250-67506272 TTGTAGCCAATCCTAAATTAGGG - Intergenic
1132257297 15:100386950-100386972 TTATAGCCACACCTATAAAGTGG + Intergenic
1134322460 16:13176224-13176246 ATATAGCCAGGCATATTTTGGGG + Intronic
1141914478 16:87085711-87085733 TTATAGCAAAACCCAAATTGGGG - Intronic
1146137556 17:30336480-30336502 TTGCAGCCAAGCCAATATGGTGG + Intergenic
1147613426 17:41814229-41814251 TTAGAGGCAGGCATATATTGGGG + Intronic
1148135559 17:45289533-45289555 AAATAGCCAAGCCTATATTATGG + Intronic
1150236428 17:63596521-63596543 TTATAGGCTAGCCTATGCTGCGG + Intergenic
1154477186 18:14773335-14773357 TTATAGGCAAGACTGTATTCTGG - Intronic
1160746836 19:715741-715763 TCATGGCCAAGCCTTGATTGTGG + Intronic
1160793663 19:934186-934208 TTATAGCCAAGCCGAGAGGGAGG + Intronic
1166022186 19:40042116-40042138 TTATAGACAAGCAAATGTTGAGG - Intronic
928221765 2:29409207-29409229 TAATAGTGAAGCATATATTGAGG - Intronic
930554082 2:52872926-52872948 TTATAGTCAATATTATATTGGGG - Intergenic
935926349 2:108073959-108073981 GTATAGCCAAGGCACTATTGTGG - Intergenic
936580464 2:113695933-113695955 TTATTTCAAAGCCTCTATTGAGG + Intergenic
939669269 2:144989623-144989645 TTGTAGCCAAGTCTATATCTGGG + Intergenic
940746447 2:157572613-157572635 TTACAGCCAATTCTAAATTGAGG - Intronic
942865463 2:180668487-180668509 TTATAGTGAAGACTATATTATGG - Intergenic
943997618 2:194790843-194790865 TTCTAGCCAAGTTTACATTGTGG - Intergenic
1177513897 21:22122942-22122964 GCATAGCCAAGACTATATAGAGG - Intergenic
1183840021 22:40491698-40491720 ATATAGCCAAGCCTAGATTGTGG - Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
955611966 3:60767337-60767359 CTATCAGCAAGCCTATATTGTGG + Intronic
959996036 3:112681610-112681632 TTTAAGCCAGGCCTATATTAAGG + Intergenic
960762391 3:121087583-121087605 TTATAGACAAGCGTATAGTTGGG + Intronic
962229318 3:133647245-133647267 TTATACCCAAACCTACTTTGAGG - Intronic
963786126 3:149536245-149536267 AAATAGCCAAGCTTATATGGAGG + Intronic
968399584 4:280985-281007 TTATTGGCAAGCCTACATTCGGG - Intronic
972372262 4:38436408-38436430 TTACAGACAAGCAAATATTGAGG - Intergenic
978687489 4:111463566-111463588 TTGTAGCTAAGCCAATACTGGGG + Intergenic
978764507 4:112390377-112390399 TTATAGCCAAGCCTATATTGAGG - Intronic
979762651 4:124426021-124426043 GCAAAGCCAAGGCTATATTGGGG - Intergenic
987211389 5:15687199-15687221 TTATAGGAAACCCTATATTTGGG + Intronic
991903422 5:71482730-71482752 TTATAGCCAATCATTTTTTGTGG + Intronic
992077463 5:73204384-73204406 TTATATCCAGGCCTATATTTAGG + Intergenic
994452844 5:99965634-99965656 TAATAGCCATGCCTCTAGTGGGG + Intergenic
994510101 5:100691578-100691600 ATATAGTCAAGACTATATTTAGG - Intergenic
995029000 5:107458409-107458431 TTATCTCCAAGGCTATATTTGGG - Intronic
996488142 5:124060544-124060566 TTATAGCCAAGCCTGATTTATGG + Intergenic
1000900835 5:166909842-166909864 TTATAGCCAGGGAAATATTGGGG + Intergenic
1001362469 5:171101803-171101825 TTACAGACAAGCAAATATTGAGG - Intronic
1001884669 5:175278562-175278584 CTATATCCAAGCCTATATACAGG - Intergenic
1003703147 6:8493290-8493312 TAATAGCCATGCCTATTTTGAGG - Intergenic
1021303630 7:19004515-19004537 CTAAAGCCAAACCTATTTTGTGG - Intergenic
1030366108 7:108648071-108648093 TTATAGCAAAGGGTATAATGTGG - Intergenic
1030965511 7:115989044-115989066 TTGTAGACAAGCAAATATTGAGG + Intronic
1032309099 7:130765902-130765924 ACATAGCCAAGACAATATTGGGG - Intergenic
1034687315 7:152984208-152984230 TTATAACCAAGCCTGTATGTAGG + Intergenic
1037163835 8:15802609-15802631 TTATAGCCATGCCCCTCTTGAGG - Intergenic
1043950619 8:86305233-86305255 TTAAAGCCAAGCCAAAATTAAGG + Intronic
1045455847 8:102378235-102378257 CTAAAACCAAGCCTTTATTGTGG - Intronic
1046348755 8:112975781-112975803 TTACAGCCAAAGCTATATTTTGG - Intronic
1050666800 9:7947212-7947234 TTATAGCCAAGCAAAAAATGTGG + Intergenic
1050750739 9:8933704-8933726 TTTCAGCCAAGTCTATTTTGGGG + Intronic
1052435724 9:28426255-28426277 TTATAGGCAAACCTATAGGGAGG - Intronic
1052671202 9:31559790-31559812 TTATAACAAAGCCTATAATATGG + Intergenic
1058750445 9:108033992-108034014 TTCTAGCCAAGACAGTATTGAGG - Intergenic
1189802883 X:44708092-44708114 ATATAGGCAAGCCTTTAATGAGG + Intergenic
1192239924 X:69320844-69320866 TTATTGCCAAGCCCACACTGTGG + Intergenic
1194560609 X:95414828-95414850 TTATTGCCAAGCATTTAATGTGG - Intergenic
1194831981 X:98634307-98634329 GTATAGCCAAAGCTATCTTGAGG + Intergenic
1197854061 X:130896099-130896121 TAAGAGCCAAGCCTAGCTTGAGG + Intronic