ID: 978764799

View in Genome Browser
Species Human (GRCh38)
Location 4:112393057-112393079
Sequence CCTAACATGTAGAATGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978764796_978764799 -7 Left 978764796 4:112393041-112393063 CCAGATTGATGAAACACCTAACA 0: 1
1: 0
2: 0
3: 15
4: 110
Right 978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 137
978764794_978764799 3 Left 978764794 4:112393031-112393053 CCTCAGGAGCCCAGATTGATGAA 0: 1
1: 0
2: 0
3: 6
4: 146
Right 978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 137
978764795_978764799 -6 Left 978764795 4:112393040-112393062 CCCAGATTGATGAAACACCTAAC 0: 1
1: 0
2: 0
3: 5
4: 163
Right 978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG 0: 1
1: 0
2: 0
3: 8
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978764799 Original CRISPR CCTAACATGTAGAATGTGGC TGG Intronic
908653579 1:66363195-66363217 CTTAACATCTTTAATGTGGCTGG + Exonic
911561654 1:99413778-99413800 CCTGACCTGTAGAATGTAACAGG + Intergenic
913037964 1:114991730-114991752 CCTAATATTAAGAATGAGGCAGG + Intronic
913206642 1:116545149-116545171 CCTAACAGCTAGAATGAGGAGGG + Intronic
918712178 1:187745180-187745202 CATAACATGTAGTATGAGGATGG - Intergenic
919329049 1:196145793-196145815 CCTAACAAATAGAATATGGAAGG - Intergenic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
923796044 1:237156693-237156715 AGTAATATGTAGAATGTGGTGGG + Intronic
924783448 1:247172681-247172703 CTTAGCACCTAGAATGTGGCTGG - Intergenic
1066192228 10:33066588-33066610 CTAAAGATGTAGAAAGTGGCTGG - Intergenic
1067511338 10:46897401-46897423 CCTAACATGTGGTATGGGTCTGG + Intergenic
1067650909 10:48154461-48154483 CCTAACATGTGGTATGGGTCTGG - Intergenic
1068154554 10:53181366-53181388 CCTTACATGTAAAATGAGGGAGG - Intergenic
1071868889 10:89769779-89769801 TCTGGCATGTAGAATGTGGAAGG + Intronic
1071957569 10:90776142-90776164 CCTACCATATAGGATATGGCAGG + Intronic
1073481316 10:103787749-103787771 CCAAACAGGAAGAATGAGGCTGG - Intronic
1074510818 10:114110374-114110396 GCTAACCTCTAGAGTGTGGCTGG + Intergenic
1076749296 10:132534334-132534356 CCTGACATATAGACTGTGGAAGG + Intergenic
1078152738 11:8773179-8773201 CCTTAAATGGAGAATGTGCCTGG + Intronic
1079074447 11:17375095-17375117 CCTCACATAAATAATGTGGCAGG + Exonic
1084219210 11:67667322-67667344 CCTGGCATGTGGAGTGTGGCAGG - Intronic
1085759102 11:79226485-79226507 CCTCACGGGAAGAATGTGGCTGG + Intronic
1086156795 11:83676105-83676127 CCTAAGCTTTAGAATGGGGCTGG + Intronic
1089670794 11:120055673-120055695 CCTGACATGTGTTATGTGGCTGG + Intergenic
1090429734 11:126635716-126635738 CCTTATCTGTAAAATGTGGCTGG + Intronic
1093291592 12:17331573-17331595 GCTAACATGTACCATGTGACAGG + Intergenic
1096224187 12:49854418-49854440 CCTAAAATGTAGATTCTGGCTGG + Intergenic
1096235330 12:49922406-49922428 CCCAGCCTGTAAAATGTGGCTGG - Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1100559914 12:95737861-95737883 CCTACCATGTGGAATGTTCCTGG + Exonic
1100784146 12:98061385-98061407 CCTAGCATCTAGAATATTGCTGG - Intergenic
1102743086 12:115225156-115225178 ACTAACAACTATAATGTGGCAGG - Intergenic
1105500208 13:20965292-20965314 CTGAGCATGTAAAATGTGGCTGG + Intergenic
1105758528 13:23492166-23492188 ACTAAAATGTGGAACGTGGCTGG + Intergenic
1106452324 13:29894377-29894399 CCTTACATGCAGAAAGTGGCTGG - Intergenic
1107727276 13:43311468-43311490 CCTACCATGTACAATGTAGTGGG + Intronic
1107989396 13:45804031-45804053 CCTAAAAAGTAAACTGTGGCTGG + Intronic
1115385276 14:32789447-32789469 CCACACCTGTAGAAGGTGGCTGG - Intronic
1116405303 14:44559117-44559139 TTTAAAATGTAAAATGTGGCCGG + Intergenic
1116744750 14:48803618-48803640 CCTAACATATAAAATATGGTTGG - Intergenic
1117747467 14:58885183-58885205 CCTCTCATGAAGAATGTGGGAGG - Intergenic
1119624796 14:76163736-76163758 CCCTACATGTAAAATGTGGATGG - Intronic
1124554529 15:30712147-30712169 TCTGAAATGCAGAATGTGGCTGG - Intronic
1124676720 15:31693530-31693552 TCTGAAATGCAGAATGTGGCTGG + Intronic
1126409324 15:48355853-48355875 CCTACGAAGTAAAATGTGGCAGG - Intergenic
1127885330 15:63194079-63194101 CCTAACAGGAAGAAGGGGGCAGG - Intronic
1128890646 15:71328920-71328942 CCTGATCTGTAGAATGAGGCTGG + Intronic
1131656143 15:94461161-94461183 CTCAACATGTAGCATTTGGCTGG + Intronic
1133713954 16:8429024-8429046 TCTAACCTCTAAAATGTGGCTGG - Intergenic
1137757395 16:50913519-50913541 CTTAGCATGTAGACTGTGGAAGG + Intergenic
1138391702 16:56675320-56675342 TGTAACATTTAGAATGTGCCAGG - Intronic
1143752515 17:9039120-9039142 CCAAACAGATAGAAAGTGGCAGG - Intronic
1143763907 17:9124956-9124978 GCTAACATGTAGCATGTGCCAGG - Intronic
1144148109 17:12417782-12417804 CCTTACATGAAGAATGGTGCTGG + Intergenic
1149293550 17:55239888-55239910 CCTAACATGGACAAGGTGGGAGG + Intergenic
1150072257 17:62161695-62161717 CCTAACATGTGGACTCTGACAGG + Intergenic
1150448925 17:65249457-65249479 CCCAACCTGTCGACTGTGGCAGG + Intergenic
1153040631 18:810739-810761 CCTTACATGTCAATTGTGGCAGG + Intronic
1155219486 18:23671416-23671438 CCCAGCAAGTAGAATGGGGCTGG + Intergenic
1156029852 18:32700088-32700110 CCTTAGATGTAAAATGTGGGAGG - Intronic
1159402536 18:67956485-67956507 CCTAAAATTTAGAATTTGGCTGG + Intergenic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1164245269 19:23422653-23422675 CCTAACGTGGAGAAGGAGGCAGG + Intergenic
1164308791 19:24028888-24028910 CCTAACATGGAGGAGGAGGCAGG - Intergenic
1165618733 19:37226135-37226157 TCAAACATGTAGCATGTGACAGG + Intronic
1166425381 19:42673572-42673594 CCTAACACATAGAATATGTCTGG - Intronic
928999352 2:37330372-37330394 CCTTACATGTAAAATGAGGGGGG + Intergenic
932092965 2:68823231-68823253 CCTAACAACTGGAATGTGCCTGG - Intronic
932492881 2:72132769-72132791 ACTAACATGCTGAATGGGGCAGG - Intronic
935219217 2:100997785-100997807 CCTCCCATGTAGAATGGGGATGG + Intergenic
936021374 2:108997527-108997549 CCTAACAGATAGAAAGAGGCAGG + Intergenic
937355747 2:121197013-121197035 CCTGTCTTGTAGATTGTGGCAGG - Intergenic
937839213 2:126508790-126508812 ACTTACAAGTAGAAAGTGGCAGG + Intergenic
941017192 2:160370606-160370628 CCACACATTTAGAAGGTGGCAGG + Intronic
943761648 2:191616268-191616290 CCTAACACATAGAATGTGAACGG - Intergenic
944853291 2:203742399-203742421 CTAAAAATGTAGAAGGTGGCTGG - Intergenic
1170272693 20:14546147-14546169 CCTAATATCTACAATGTGGATGG - Intronic
1175139728 20:56851652-56851674 CCGAACATCTACAATGTGGTGGG + Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1179050886 21:37887843-37887865 CCTATCCTGCAGAATGTGGAAGG + Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1181896362 22:26111385-26111407 TCTAACAAGTAGAATGTAGTGGG + Intergenic
1182067276 22:27439430-27439452 CCGAACATATAGCATGTGCCAGG + Intergenic
950255352 3:11500252-11500274 TCTAACATGTAGAATTTGGTTGG + Intronic
952455556 3:33468369-33468391 CCTACCAAGGAGAATGGGGCAGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955591579 3:60541470-60541492 CCCCACATGTAGAATATGGTGGG - Intronic
956679638 3:71766385-71766407 GATAACATACAGAATGTGGCTGG + Intergenic
958451003 3:94272372-94272394 CCTAACTTCTAACATGTGGCAGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964212745 3:154246307-154246329 TTGAACATGGAGAATGTGGCTGG + Intronic
965587665 3:170333455-170333477 TCTACCATGTACAATCTGGCAGG - Intergenic
967091322 3:186137273-186137295 CCCTACATGTAAAATGGGGCTGG - Intronic
967676506 3:192305457-192305479 ACTGACGTGTAGAATCTGGCTGG - Intronic
973181140 4:47269704-47269726 CTTAACATGTATTATGTGTCGGG + Intronic
974510214 4:62830404-62830426 CCTAAGATGGAGAATAAGGCTGG - Intergenic
975074553 4:70189069-70189091 TCTAACATGTAGATTGTATCAGG - Intergenic
978442502 4:108748789-108748811 CATAACCTGTAGAATTTAGCAGG + Intronic
978764799 4:112393057-112393079 CCTAACATGTAGAATGTGGCTGG + Intronic
978827680 4:113044407-113044429 TCTAACCTGTAGAATGTAGGTGG - Intronic
986010814 5:3713438-3713460 CCTCACATCTAAAATGTGGGTGG - Intergenic
986350902 5:6878545-6878567 CATAACATGTAGACTGTGCAGGG + Intergenic
987793602 5:22599937-22599959 ACAAACATGCAGTATGTGGCTGG - Intronic
991361694 5:65827515-65827537 GCTAAGATGGAGAATGTGACTGG + Exonic
998137340 5:139681094-139681116 CCTGACATGGAGGCTGTGGCAGG + Exonic
1000444430 5:161302403-161302425 CCTACCATGAAGAAAGTTGCAGG - Intronic
1007362771 6:41370688-41370710 CCTAAGATGTGGAAAGTGCCTGG - Intergenic
1008592392 6:53007631-53007653 CCTAAAATGTTGACTCTGGCTGG + Intronic
1012391367 6:98744475-98744497 CCTAACAGTCAGAAGGTGGCTGG - Intergenic
1015258507 6:131207629-131207651 CTAAAGATGTAGTATGTGGCTGG - Intronic
1016582944 6:145649877-145649899 CCTTAGATGTATAATGTGTCGGG + Intronic
1017338431 6:153289961-153289983 CCTAACAAGTAGAATCTGAGTGG - Intergenic
1020138801 7:5601087-5601109 CCTAAAAAGTAGAATGGGACTGG - Intronic
1023697069 7:42858363-42858385 ACTAACATTTAGAATGTGCTGGG - Intergenic
1023720460 7:43088265-43088287 TCTAATGAGTAGAATGTGGCAGG + Intergenic
1023753180 7:43391041-43391063 CCAAACCTTTAGAATTTGGCAGG + Intronic
1024637428 7:51301890-51301912 GATAAAATGTAAAATGTGGCTGG - Intronic
1025781862 7:64609020-64609042 CCAAACATGTAGAATTTGGGAGG + Intergenic
1025869975 7:65422447-65422469 CCTGAGATGTAAAATGTGTCAGG - Intergenic
1026641544 7:72130575-72130597 CCTAACGTGTAGAGTATGTCTGG + Intronic
1028633901 7:92965942-92965964 CATAAAATGTAGAAAGAGGCTGG + Intergenic
1032202406 7:129831460-129831482 CCTAACATAAAGCATGTGCCAGG + Exonic
1035714762 8:1745366-1745388 CCAAACGTGTAGGCTGTGGCTGG + Intergenic
1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG + Intronic
1036801724 8:11797486-11797508 CTGAACATCTACAATGTGGCAGG - Intronic
1038015741 8:23513084-23513106 TCTTACATTTAGAATGTGGCAGG + Intergenic
1040548588 8:48421206-48421228 CCTAACATGTCCAATGTGTTTGG - Intergenic
1041846185 8:62331261-62331283 CCTAACATGTAGGAGTTAGCTGG - Intronic
1043392608 8:79806396-79806418 ACTAACATGTACTATGTGCCAGG + Intergenic
1043526562 8:81104089-81104111 CCTACCATGTGGAAGGTGGGTGG - Intronic
1047121899 8:121913978-121914000 CCTAACTTATAGAAAGTGGAAGG - Intergenic
1047781450 8:128114872-128114894 CATGACATGTACAATCTGGCTGG + Intergenic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049264491 8:141660195-141660217 CCTAACTTGGACAATCTGGCTGG + Intergenic
1050565654 9:6879762-6879784 CCTAATTTGTAAAATGTGGTTGG + Intronic
1050907632 9:11025926-11025948 CAAAACACATAGAATGTGGCTGG - Intergenic
1060239734 9:121892723-121892745 TCTTCCATGGAGAATGTGGCGGG - Intronic
1185834515 X:3332538-3332560 CTTAAAAAGAAGAATGTGGCCGG - Intronic
1186817898 X:13256003-13256025 ACTGACATGTAGAATATAGCAGG - Intergenic
1187226622 X:17379476-17379498 AATAACTTGTAGACTGTGGCTGG + Intronic
1192723337 X:73723535-73723557 ACACACCTGTAGAATGTGGCTGG + Intergenic
1194234694 X:91368027-91368049 CCTAACTAGTAAAATATGGCAGG - Intergenic
1195041070 X:101014832-101014854 CTTAAAGTGTAGAATTTGGCTGG - Intronic
1197587889 X:128372126-128372148 CCTCACTTGTAAAATGTGGATGG - Intergenic
1199476867 X:148255369-148255391 CCCCACATGTAGAACCTGGCAGG + Intergenic