ID: 978770819

View in Genome Browser
Species Human (GRCh38)
Location 4:112455042-112455064
Sequence TTGTGGTTGTAGAACTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978770815_978770819 2 Left 978770815 4:112455017-112455039 CCTGATGTTGGTAAAATTCAGTT No data
Right 978770819 4:112455042-112455064 TTGTGGTTGTAGAACTGAGGTGG No data
978770814_978770819 13 Left 978770814 4:112455006-112455028 CCAATCTCATTCCTGATGTTGGT No data
Right 978770819 4:112455042-112455064 TTGTGGTTGTAGAACTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978770819 Original CRISPR TTGTGGTTGTAGAACTGAGG TGG Intergenic
No off target data available for this crispr