ID: 978771382

View in Genome Browser
Species Human (GRCh38)
Location 4:112459538-112459560
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978771382_978771384 9 Left 978771382 4:112459538-112459560 CCTTTTCCAGGTGTAAATATTAT No data
Right 978771384 4:112459570-112459592 CTTCTGTCATTCTTCCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978771382 Original CRISPR ATAATATTTACACCTGGAAA AGG (reversed) Intergenic
No off target data available for this crispr