ID: 978771383

View in Genome Browser
Species Human (GRCh38)
Location 4:112459544-112459566
Sequence AGACAAATAATATTTACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978771383_978771384 3 Left 978771383 4:112459544-112459566 CCAGGTGTAAATATTATTTGTCT No data
Right 978771384 4:112459570-112459592 CTTCTGTCATTCTTCCACAAAGG No data
978771383_978771387 30 Left 978771383 4:112459544-112459566 CCAGGTGTAAATATTATTTGTCT No data
Right 978771387 4:112459597-112459619 CCAGCATTCACTCAAATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978771383 Original CRISPR AGACAAATAATATTTACACC TGG (reversed) Intergenic
No off target data available for this crispr