ID: 978771384

View in Genome Browser
Species Human (GRCh38)
Location 4:112459570-112459592
Sequence CTTCTGTCATTCTTCCACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978771382_978771384 9 Left 978771382 4:112459538-112459560 CCTTTTCCAGGTGTAAATATTAT No data
Right 978771384 4:112459570-112459592 CTTCTGTCATTCTTCCACAAAGG No data
978771383_978771384 3 Left 978771383 4:112459544-112459566 CCAGGTGTAAATATTATTTGTCT No data
Right 978771384 4:112459570-112459592 CTTCTGTCATTCTTCCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978771384 Original CRISPR CTTCTGTCATTCTTCCACAA AGG Intergenic
No off target data available for this crispr