ID: 978772151

View in Genome Browser
Species Human (GRCh38)
Location 4:112467772-112467794
Sequence GACAGCTTTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
978772151_978772155 15 Left 978772151 4:112467772-112467794 CCAGTAACAGGCCAAAAGCTGTC No data
Right 978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225
978772151_978772156 16 Left 978772151 4:112467772-112467794 CCAGTAACAGGCCAAAAGCTGTC No data
Right 978772156 4:112467811-112467833 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
978772151_978772154 11 Left 978772151 4:112467772-112467794 CCAGTAACAGGCCAAAAGCTGTC No data
Right 978772154 4:112467806-112467828 GAGTAGTTATCTGCAGAAGATGG 0: 178
1: 192
2: 102
3: 110
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
978772151 Original CRISPR GACAGCTTTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr